IGEM:Cambridge/2008/Notebook/Voltage/Gene Design: Difference between revisions
From OpenWetWare
Jump to navigationJump to search
| Line 34: | Line 34: | ||
==Promoter and RBS Selection== | ==Promoter and RBS Selection== | ||
===Promoter=== | ===Promoter=== | ||
*The promoter chosen for use with Kdp was OsmY [http://partsregistry.org/Part:BBa_J45992 (Part BBa_J45992).] | *The promoter chosen for use with Kdp was OsmY [http://partsregistry.org/Part:BBa_J45992 (Part BBa_J45992).] | ||
Revision as of 16:11, 4 September 2008
KdpF-C Biobrick
Gene Selection
- Kdp is a well documented P-Type K+ ATPase found naturally in E.coli, used to actively pump ions into the cell.
- It consists of a 6-gene operon: F,A,B,C,D,E Where F-C are the functional membrane protein subunits, and D-E comprises a bacterial 2-component regulatory system.
- Literature shows that Kdp acts as a high-affinity transport system, and works most effectively at low external potassium concentrations, where a change in ion flux would be most likely to produce a measurable voltage difference.
- The D-E 2-component system consists of a membrane protein turgidity sensor and a transcription factor. It controls Kdp operon expression in vivo, by reducing gene expression when turgor is high.
- Since we wish to over-express Kdp, we decided not to include the regulatory system in our biobrick. (Osmotic buffering would be used instead.)
Amplification from E.coli MG1655
- This was performed via PCR amplification of the genome template using the following primers:
-Forward: ATATGAATTCATATTCTAGATGAGTGCAGGCGTGATAACCGGCGTATT
EcoRI XbaI
-Reverse: CTCTCTGCAGCTCTACTAGTTTATTCATCAAGTTTATCCAGCGCCAGAT
PstI SpeI
- Primer overhangs incorporated the biobrick prefix and suffix into the section, restriction sites shown in bold .
- The result of this PCR is shown below:
Integration into Vector
- The vector used was low copy-number plasmid pSB4C5, with chloramphenicol resistance and a death gene as selection markers.
- Kdp PCR product and pSB4C5 were both cut with EcoRI & SpeI, (vector backbone was dephosphorylated to prevent circularisation) then ligation into the vector can occur as shown.
- . . . . . . . . . . . . . . . . . . . . . . . .
- Note: pSB4C5_Kdp biobrick plasmid has no promoter/RBS and so Kdp is not expressed in transformants.
Promoter+RBS Biobrick
Promoter and RBS Selection
Promoter
- The promoter chosen for use with Kdp was OsmY (Part BBa_J45992).
- It is a stationary phase promoter, and since we require high cell densities in our final "voltage measurement" medium, we want Kdp to only be expressed in stationary phase.
- This will reduce the metabolic and osmotic stress on dividing cells in exponential phase.
Ribosome Binding Site
- Three different strength RBSs were investigated, B0030, B0031 and B0032.
- B0030 is the strongest(15bp length), B0031 medium(14bp) and B0032 weakest(13bp).
- Investigating three will help us determine the optimum levels