User:Katherine H. Loh: Difference between revisions

From OpenWetWare
Jump to navigationJump to search
Line 39: Line 39:


==Research interests==
==Research interests==
<!-- Feel free to add brief descriptions to your research interests as well -->
# Interest 1
# Interest 2
# Interest 3


==Publications==
==Publications==

Revision as of 01:11, 10 November 2008

I am a new member of OpenWetWare!

Contact Info

Katherine H. Loh (an artistic interpretation)

Art/Biotechnology Exhibit

Current interactions between science and the public

Goals and summary

Plans

  • Exhibit
  1. Timing diagram
  2. "Parts" and "devices"
  • Laboratory
  1. First experimental steps
  2. Control experiment

Resources

Societal Impact

Mod 2: Protein Engineering

Day 1: PCR Primers Forward primer: FLAP landing sequence 5’ CAAATAAGGGAATTTCTTGAAGAGATTGTAGATACACAA tccatggaaaagagaagatg 3’

Reverse Primer: FLAP landing sequence 5’ TGT AAT AAT ATT GGG AAT TAA GGT GCA TTT TCG TAT CCT tacgactcactatagggcga 3’



Research interests

Publications