SBB09Ntbk-Hank Shih: Difference between revisions

From OpenWetWare
Jump to navigationJump to search
Hank Shih (talk | contribs)
No edit summary
Hank Shih (talk | contribs)
No edit summary
Line 182: Line 182:
   18. Take out columns and cap the tubes.
   18. Take out columns and cap the tubes.
   19. Clean up - note the P1 buffer is stored at 4degC and all the rest at room temperature.  
   19. Clean up - note the P1 buffer is stored at 4degC and all the rest at room temperature.  
</pre>
After the miniprep, I did an analytical mapping to make sure that the product was as expected. I followed the mapping protocol here:
<pre>
Set up the following 10uL reaction in a PCR tube:
6.5 uL ddH2O
2uL Miniprepped plasmid
1uL 10x NEB Buffer 2
0.5uL EcoRI
0.5uL BamHI (for parts >250bp) or XhoI (for parts <250bp)
Incubate at 37 on the thermocycler for 30 minutes
</pre>
</pre>

Revision as of 22:50, 15 March 2009

02/09/2009
Finished making basic part for M10024. This is the final construction file:

Construction of {a~eaeA_Display>} basic part
PCR Bhs001F/Bhs002R on E. coli strain 0157:H7     (146 bp, gp = A)
PCR Bhs002F/Bhs003R on E. coli strain 0157:H7     (1889 bp, gp = B)
----------------------------
PCR Bhs001F/Bhs003R on A+B                       (2009 bp, EcoRI/BamHI)
Digest pBca9495CA-Bca1144#5                      (EcoRI/BamHI, 3039+910, L)
Product is pBca9495CA-M10024                     {a~eaeA_Display>}
----------------------------
Bhs001F  Forward EcoRI for a~eaeA_Display>           cccaaGAATTCatgAGATCTtaacATGATTACTCATGGTTG
Bhs002F  Removing the EcoRI site from eaeA_Display   GTTAATCAGAACTCATTTGCAAATGG
Bhs002R  Removing the EcoRI site from eaeA_Display   CCATTTGCAAATGAGTTCTGATTAAC
Bhs003R  Reverse BamHI for a~eaeA_Display>           GCAAAggatccGGCCTTGGTTTGATCAAAAAATATAACCGCAC

02/18/2009
Today, I've setup my first two PCR reactions with Bhs001F/Bhs002R and Bhs002F/Bhs003R. The standard protocol was followed. The mixture was composed of the following:

24uL ddH2O
3.3uL 10x Expand Buffer "2"
3.3uL dNTPs (2mM in each)
1uL Oligo 1, 10uM
1uL Oligo 2, 10uM
0.5uL Expand polymerase "1"
0.5uL Template DNA

The Bhs001F/Bhs002R PCR had an expected product of 146bp and was ran on the 55 program. The Bhs002F/Bhs003R PCR had an expected product of 1889bp and was ran on the 2K55 program.

02/23/2009
Today, I got both PCR products back. In order to proceed to the next step, I need to gel purify my PCR products. This was also a great time to see if the PCR products came out as expected.

To setup my gel, I've mixed 5uL of PCR product with 5 uL of loading buffer. This was a change from protocol because the loading buffer looked quite diluted. This mixture was loaded into the 1% agarose gel. The following picture is the results:

The gel indicates the products are within the expected range of BPs (PCR1 near 146bp and PCR2 near 1889bp). After confirming this, I proceeded with gel purifying the PCR products. In order to do this, I followed the Zymo Gel Purification protocol:

Zymo Gel Purification

    * All spins until the drying step are 15 second full speed spins. 

   1. cut out bands minimizing extra gel matter.
   2. put in ependorf tube and add 600uL of Zymo ADB buffer (brown bottle).
   3. heat at 55, shake and/or vortex until the gel has dissolved.
   4. If the DNA is <300bp add 250uL of isopropanol
   5. transfer into the Zymo column inside a collection tube (small clear guys)
   6. spin through, discard waste.
   7. Add 200 uL of PE buffer (which is basically 70% ethanol)
   8. spin through, discard waste.
   9. Add 200 uL of PE buffer
  10. spin through, discard waste.
  11. spin for 90 seconds, full speed to dry.
  12. elute with 8.5 uL of water into a fresh Eppendorf tube 

No deviations were made from the protocol. Unfortunately, I ran out of time to setup the second PCR reaction.

02/25/2009
The goal for today is to setup my second PCR reaction. I've already gel-purified and obtained PCR product A and B on Monday. These two products will be my DNA template for this PCR reaction. For this PCR, I will be using oligos Bhs001F/Bhs003R. The PCR mixture was as followed:

24uL ddH2O
3.3uL 10x Expand Buffer "2"
3.3uL dNTPs (2mM in each)
1uL Oligo 1, 10uM
1uL Oligo 2, 10uM
0.5uL Expand polymerase "1"
0.5uL Template DNA

In order to get the 0.5uL of template DNA, I've mixed 1uL of PCR product A with 1uL of PCR product B before extracting 0.5uL of the mixture. This PCR mixture was ran on the 4K55 program.


03/02/2009
Today, I got the final PCR product after running it on 4K55. Before my cleanup, I did an analytical gel:

Unfortunately, the DNA ladder did not work as intended. We used 8uL of DNA ladder, which is plenty by all accounts. In order to save time, I proceeded with cleanup so I was unable to redo the analytical gel. However, the analytical gel does indicate that my PCR product is in roughly the correct range (2008bp).

For the cleanup, I followed the Regular Zymo Cleanup protocol:

   1. Add 180 uL of Zymo ADB buffer (brown bottle) to a 33uL or 50uL reaction.
   2. Transfer into the Zymo column (small clear guys)
   3. spin through, discard waste.
   4. Add 200 uL of PE or Zymo Wash buffer (which is basically 70% ethanol)
   5. spin through, discard waste.
   6. Add 200 uL of PE or Zymo Wash buffer
   7. spin through, discard waste.
   8. spin for 90 seconds, full speed to dry.
   9. elute with water into a fresh Eppendorf tube, use the same volume of water as the volume of the original reaction 

No deviations were made from this protocol.

After the cleanup, I proceeded with digestion of my PCR product. I mixed:

 8uL of eluted PCR product
 1uL of NEB Buffer 2
 0.5uL EcoRI
 0.5uL BamHI

This reaction was then incubated for 1hr. Unfortunately, I ran out of time at this point. To prevent the DNA from being digested up completely, I did a cleanup here.

03/04/2009
Today, I started on my Gateway reaction. In a 0.5mL tube, I mixed:

 3uL ddH2O
 0.5uL Donor plasmid (a pBca1256-Bjh1857)
 0.5uL Recipient plasmid (a pBca1254AK)

After this mixing, Chris essentially followed the Gateway protocol and mixed the enzymes for us. The protocol is as followed:

    * Add 1uL of LR Clonase
    * Slam on bench upside down to mix
    * Quick spin to send it to the bottom of the tube
    * Incubate at 25 degrees on the thermocycler for 1hr
    * Add 0.5uL proteinase K
    * Slam on bench upside down to mix
    * Quick spin to send it to the bottom of the tube
    * Incubate at 37 degrees on the thermocycler for 10min.
    * Put on ice, proceed to transformation 

Now, I prepared the SOEing reaction for transformation. With the digested DNA, I proceeded with ligation. I setup the following mixture:

 6.5uL ddH2O
 1uL T4 DNA Ligase Buffer (small red or black-striped tubes)
 1uL Vector digest
 1uL Insert digest
 0.5uL T4 DNA Ligase

The vector digest was pBca9495CA-Bca1144#5. This reaction was mixed and incubated for 30 minutes on the desktop.

At this point, both my SOEing and Gateway are ready for transformation. I followed the transformation protocol:

   1. Thaw a 200 uL aliquot of cells on ice
   2. Add 50 uL of water
   3. Add 30 uL of KCM salts
   4. Put your ligation mixture on ice, let it cool a minute or two
   5. Add 75 uL of the cell cocktail to the ligation, pipette up and down gently to mix
   6. Let sit on ice for 10 min
   7. Heat shock for 2 min at 42
   8. Put back on ice for 1 min
   9. For ampicillin selection, you can plate immediately, otherwise:
  10. Add 100uL of LB, let shake in the 37 degree incubator for 40 min
  11. Plate on selective antibiotics, let incubate overnight 

The Gateway reaction was plated on AK while the SOEing reaction was plated on CA.

03/06/2009
Today, I picked colonies. Unfortunately, the SOEing reaction (M10024) failed and had no colonies. The Gateway reaction (M10025) had about 8 colonies. Two colonies were chosen via a toothpick and dropped into separate test tubes with LB and antibiotics (AK).

03/09/2009
Today, I will do miniprep on my Gateway (M10025) clones. The test tubes seems to be saturated with the bacteria. For the miniprep, I followed the protocols with no deviation:

   1. Pellet around 1.5 mL or 2 mL saturated culture by spinning full speed, 30 seconds.
   2. Dump supernatant, repeat to pellet another 1.5 mL (for a total of 3 mL)
   3. Add 250uL of P1 buffer into each tube. Resuspend the cells using a vortexer.
   4. Add 250uL of P2 buffer (a base that denatures everything and causes cells to lyse). 
Gently mix up and down. Solution should become clearer.
   5. Add 350uL of N3 buffer (an acid of pH ~5 that causes cell junk - including protein and chromosomal DNA - to
 precipitate, and leaves plasmids and other small molecules in solution). Slowly invert a few times, then shake.
   6. Spin in centrifuge at top speed for 5 minutes.
   7. Label blue columns with an alcohol-resistant lab pen.
   8. Pour liquid into columns, and place the columns into the centrifuge. Spin at 12000 rpm for 30 seconds.
   9. Dump liquid out of the collectors under the columns (the DNA should be stuck to the white resin)
  10. Wash each column with 500 uL of PB buffer.
  11. Spin in centrifuge at 12000rpm for approximately 15 seconds, then flick out the liquid again.
  12. Wash with 750uL of PE buffer (washes the salts off the resins).
  13. Spin in centrifuge at 12000rpm for approximately 15 seconds and flick out liquid again.
  14. Spin in centrifuge at full speed for 1 minute to dry off all water and ethanol.
  15. Label new tubes and put columns in them.
  16. Elute them by squirting 50uL of water down the middle of the column (don't let it stick to the sides).
  17. Spin in centrifuge at top speed for 30 seconds.
  18. Take out columns and cap the tubes.
  19. Clean up - note the P1 buffer is stored at 4degC and all the rest at room temperature. 

After the miniprep, I did an analytical mapping to make sure that the product was as expected. I followed the mapping protocol here:

Set up the following 10uL reaction in a PCR tube:

6.5 uL ddH2O
2uL Miniprepped plasmid
1uL 10x NEB Buffer 2
0.5uL EcoRI
0.5uL BamHI (for parts >250bp) or XhoI (for parts <250bp)

Incubate at 37 on the thermocycler for 30 minutes