User:Torsten Waldminghaus/qPCR-Primers: Difference between revisions

From OpenWetWare
Jump to navigationJump to search
No edit summary
No edit summary
Line 365: Line 365:
|
|
|-
|-
!ibpAfw
!ibpAqPCRfw
|AGGTAGCCAGAACACCCATC
|AGGTAGCCAGAACACCCATC
|qPCR for region 3865545 on Escherichia coli str. K-12 substr. MG1655 complete genome ibpA, region should give high sigma32 IP
|qPCR for region 3865545 on Escherichia coli str. K-12 substr. MG1655 complete genome ibpA, region should give high sigma32 IP
|
|
|-
|-
!ibpArv
!ibpAqPCRrv
|AAGTCCGCTGATAAGGCTTG
|AAGTCCGCTGATAAGGCTTG
|qPCR for region 3865545 on Escherichia coli str. K-12 substr. MG1655 complete genome ibpA, region should give high sigma32 IP
|qPCR for region 3865545 on Escherichia coli str. K-12 substr. MG1655 complete genome ibpA, region should give high sigma32 IP
|
|
|-
|-
!ibpAprobe
!ibpAqPCRprobe
|CGCGTCCTCATCGGCTACGA
|CGCGTCCTCATCGGCTACGA
|HPLC5'Fam - 3'Tamra qPCR for region 3865545 on Escherichia coli str. K-12 substr. MG1655 complete genome ibpA, region should give high sigma32 IP
|HPLC5'Fam - 3'Tamra qPCR for region 3865545 on Escherichia coli str. K-12 substr. MG1655 complete genome ibpA, region should give high sigma32 IP

Revision as of 12:57, 22 April 2009

  • All primers are in concentrations of 100pmol/μL
  • All Vibrio cholerae primers could be used for strain O1 biovar eltor str. N16961 as well as strain 2740-80 (identical sequence in the regions spanned by primers
Name Sequence Characteristics Probe set number
uvrDfw AGTTCCCGCAGGTGTTTATC qPCR for uvrD-region on E. coli chromosome with no GATC-sites (Region B from [1])(region contains no HphI site so it can be used as control in methylation analysis) 1
uvrDrv GTCAGCGTCAGTTTCTGCAT qPCR for uvrD-region on E. coli chromosome with no GATC-sites (Region B from [1])(region contains no HphI site so it can be used as control in methylation analysis) 1
uvrDprobe AGACGCCCGCCTTCATCCAG HPLC-pure 5'Fam - 3'Tamra qPCR for uvrD-region on E. coli chromosome with no GATC-sites (Region B from [1])(region contains no HphI site so it can be used as control in methylation analysis) 1
yahEFfw CCATCGAGACGATCAAAGAA qPCR for yahEF-region on E. coli chromosome with many GATC-sites (Region 2 from [1]) 2
yahEFrv CAGCATCTGGCTTTGTTGTT qPCR for yahEF-region on E. coli chromosome with many GATC-sites (Region 2 from [1]) 2
yahEFprobe AACTCGCGTCCTTCGGCAGC HPLC5'Fam - 3'Tamra qPCR for yahEF-region on E. coli chromosome with many GATC-sites (Region 2 from [1]) 2
cluster-fw CTGACTGATGAGATCCAACGA qPCR for GATC-cluster 14
cluster-rv CTGGTGCTACGCCTGAATAA qPCR for GATC-cluster 14
cluster-p AAATTCGACCCGGCTGTCGC HPLC-pure 5'Fam - 3'Tamra qPCR for GATC-cluster 14
761139p CCAGGAAGCCCACGGATTCG HPLC-pure 5'Fam - 3'Tamra qPCR for sucB-region on E. coli chromosome with many GATC-sites 6
761139fw GAGATCCTGCCGATGATGTA qPCR for sucB-region on E. coli chromosome with many GATC-sites 6
761139rv TTCCAGCAACTCTTTGATCG qPCR for sucB-region on E. coli chromosome with many GATC-sites 6
797735fw CGTCCTGGCGTATCGTATC qPCR for pgl-region on E. coli chromosome with isolated GATC-site 4
797735rv GCATTGTAAGAACCTACAAAGACAA qPCR for pgl-region on E. coli chromosome with isolated GATC-site 4
797735p TTTGCCGCAGAGTCTGCGCT HPLC-pure 5'Fam - 3'Tamra qPCR for pgl-region on E. coli chromosome with isolated GATC-site 4
1504230fw CGCCTTCAGTTTATGATCCA qPCR for ydcN-region on E. coli chromosome with many GATC-sites 13
1504230rv TCGAGAAGTGTTCAAAGCAGA qPCR for ydcN-region on E. coli chromosome with many GATC-sites 13
1504230p TGATCACCATCGCCTGCTGTTG HPLC-pure 5'Fam - 3'Tamra qPCR for ydcN-region on E. coli chromosome with many GATC-sites 13
1514191fw ATACTGTTTGGCAGAGGCAA qPCR for ydcW-region on E. coli chromosome with isolated GATC-site 12
1514191rv GGTATGGCTGATGATGTGCT qPCR for ydcW-region on E. coli chromosome with isolated GATC-site 12
1514191p TGACCGGTCAGCGGATCACC HPLC-pure 5'Fam - 3'Tamra qPCR for ydcW-region on E. coli chromosome with isolated GATC-site 12
2318305fw ATAATCACCTACGCGCCTTC qPCR for atoSC-region on E. coli chromosome with isolated GATC-site 5
2318305rv ACCTGCCTGCCTGAATAAAC qPCR for atoSC-region on E. coli chromosome with isolated GATC-site 5
2318305p TGCCGCAGATCACCCTGGTC HPLC-pure 5'Fam - 3'Tamra qPCR for atoSC-region on E. coli chromosome with isolated GATC-site 5
2351285fw ACACATTGCCGAATATGCC qPCR for glpAB-region on E. coli chromosome with many GATC-sites 16
2351285rv GTTAATGCGGTGATCCATGA qPCR for glpAB-region on E. coli chromosome with many GATC-sites 16
2351285p CTGCGCATTCGCATGTTCCC HPLC-pure 5'Fam - 3'Tamra qPCR for glpAB-region on E. coli chromosome with many GATC-sites 16
2923803fw GTCAGCCACCTGCTGAAAT qPCR for queF-region on E. coli chromosome with isolated GATC-site 15
2923803rv ATACTGAATTTGGAGCGAACC qPCR for queF-region on E. coli chromosome with isolated GATC-site 15
2923803p TGCCTGATCACCCATCAACCAGA HPLC-pure 5'Fam - 3'Tamra qPCR for queF-region on E. coli chromosome with isolated GATC-site 15
2952960fw CTACTGTTTCGCGGATCTCA qPCR for recD-region on E. coli chromosome with many GATC-sites 8
2952960rv CAACTGCTTGCAGAACCATT qPCR for recD-region on E. coli chromosome with many GATC-sites 8
2952960p CTGGTGATCACCCGCGCATT HPLC-pure 5'Fam - 3'Tamra qPCR for recD-region on E. coli chromosome with many GATC-sites 8
3923874fw GCCCTGTGGATAACAAGGAT qPCR for oriC-region on E. coli chromosome with many GATC-sites 18
3923874rv CCTCATTCTGATCCCAGCTT qPCR for oriC-region on E. coli chromosome with many GATC-sites 18
3923874p CGGTCCAGGATCACCGATCATTC HPLC-pure 5'Fam - 3'Tamra qPCR for oriC-region on E. coli chromosome with many GATC-sites 18
3921366fw GAGAATATGGCGTACCAGCA qPCR for gidB-region on E. coli chromosome with isolated GATC-site 7
3921366rv AAGACGCAGGTATTTCGCTT qPCR for gidB-region on E. coli chromosome with isolated GATC-site 7
3921366p CAACCTGACTTCGGTCCGCG HPLC-pure 5'Fam - 3'Tamra qPCR for gidB-region on E. coli chromosome with isolated GATC-site 7
4301774fw CTGAATAACTCGCCTCGTGA qPCR for mdtO-region on E. coli chromosome with isolated GATC-site 10
4301774rv ATTCCCGTCTTCATGGTTTC qPCR for mdtO-region on E. coli chromosome with isolated GATC-site 10
4301774p TAAGCGCCGATCACCGGGAT HPLC-pure 5'Fam - 3'Tamra qPCR for mdtO-region on E. coli chromosome with isolated GATC-site 10
4321507fw AGCCAGAGGTGGAGTTAGGA qPCR for phnD-region on E. coli chromosome with many GATC-sites 9
4321507rv ACAACCTGAACGATCTGCTG qPCR for phnD-region on E. coli chromosome with many GATC-sites 9
4321507p TCTCACCTTTGGCAATGGCGA HPLC-pure 5'Fam - 3'Tamra qPCR for phnD-region on E. coli chromosome with many GATC-sites 9
ter-fw TCCTCGCTGTTTGTCATCTT qPCR for ter-region (ydeE cds) on E. coli chromosome with isolated GATC-site 17
ter-rv GGTCTTGCTCGAATCCCTT qPCR for ter-region (ydeE cds) on E. coli chromosome with isolated GATC-site 17
ter-p CATCAGCACCCACGCAGCAA HPLC-pure 5'Fam - 3'Tamra qPCR for ter-region (ydeE cds) on E. coli chromosome with isolated GATC-site 17
datA-fw CAAGCTGTGGATGAATCAGG qPCR for datA-region on E. coli chromosome (region contains HphI site that does not overlap GATC so it can be used as control in methylation analysis) 3
datA-rv AAATGCGTGCATAGTCGAAG qPCR for datA-region on E. coli chromosome (region contains HphI site that does not overlap GATC so it can be used as control in methylation analysis) 3
datA-p CAATCACCCGAACCAGACGCTG HPLC-pure 5'Fam - 3'Tamra qPCR for datA-region on E. coli chromosome (region contains HphI site that does not overlap GATC so it can be used as control in methylation analysis) 3
ori1fw AGATCAGCGTTGTCTTCACG qPCR for ori1-region on Vibrio cholerae chromosome 1(region arround 2959573-2959873 Vibrio cholerae O1 biovar eltor str. N16961) 19
ori1rv CCATGGGCACTAAAGAACCT qPCR for ori1-region on Vibrio cholerae chromosome 1(region arround 2959573-2959873 Vibrio cholerae O1 biovar eltor str. N16961) 19
ori1Probe TTCCGCACGCGAAGTGAACA HPLC-pure 5'Fam - 3'Tamra qPCR for ori1-region on Vibrio cholerae chromosome 1(region arround 2959573-2959873 Vibrio cholerae O1 biovar eltor str. N16961) 19
ter1Rfw GCTATGGTGGAAGCACAAGA qPCR for ter1-region on Vibrio cholerae chromosome 1 according to [2](region arround 2959573-2959873 Vibrio cholerae O1 biovar eltor str. N16961) 21
ter1Rrv CTCGTTCAAAGTCCGCTTG qPCR for ter1-region on Vibrio cholerae chromosome 1 according to [2](region arround 2959573-2959873 Vibrio cholerae O1 biovar eltor str. N16961) 21
ter1Rprobe TGCGCTTTCACACGCTGCTC HPLC 5'Fam - 3'Tamra qPCR for ter1-region on Vibrio cholerae chromosome 1 according to [2](region arround 2959573-2959873 Vibrio cholerae O1 biovar eltor str. N16961) 21
ori2fw CCTTGAGCTTGAGATTGCTG qPCR for ori2-region on Vibrio cholerae chromosome 2 (region arround 1070137-1070437 Vibrio cholerae O1 biovar eltor str. N16961) 20
ori2rv GCCGCCCTACTATCGTTAAA qPCR for ori2-region on Vibrio cholerae chromosome 2 (region arround 1070137-1070437 Vibrio cholerae O1 biovar eltor str. N16961) 20
ori2probe TGCTCACGCTGAGCCTCATTCA HPLC 5'Fam - 3'Tamra qPCR for ori2-region on Vibrio cholerae chromosome 2 (region arround 1070137-1070437 Vibrio cholerae O1 biovar eltor str. N16961) 20
ter2Rfw CCAAAGTGCAACCGACTAAA qPCR for ter2-region on Vibrio cholerae chromosome 2 according to [2] (region arround 501350-501650 Vibrio cholerae O1 biovar eltor str. N16961 ) 22
ter2Rrv ACGGCTAAACCAACCAGTTT qPCR for ter2-region on Vibrio cholerae chromosome 2 according to [2] (region arround 501350-501650 Vibrio cholerae O1 biovar eltor str. N16961 ) 22
ter2Rprobe TCGGCTCTGGCTCTTTCTTCTGC HPLC 5'Fam - 3'Tamra qPCR for ter2-region on Vibrio cholerae chromosome 2 according to [2] (region arround 501350-501650 Vibrio cholerae O1 biovar eltor str. N16961 ) 22
ter1Cfw CACATACACGCAAACCACAA qPCR for ter1-region on Vibrio cholerae chromosome 1 according to [3] (region arround 1514728-1515028 Vibrio cholerae O1 biovar eltor str. N16961) 23
ter1Crv CTTACAGAAGCACGCCATTC qPCR for ter1-region on Vibrio cholerae chromosome 1 according to [3] (region arround 1514728-1515028 Vibrio cholerae O1 biovar eltor str. N16961) 23
ter1Cprobe CCAGCCGCAATCTTGCCAAA HPLC 5'Fam - 3'Tamra qPCR for ter1-region on Vibrio cholerae chromosome 1 according to [3] (region arround 1514728-1515028 Vibrio cholerae O1 biovar eltor str. N16961) 23
ter2Cfw AGTTCGGTGAGATTGGCATT qPCR for ter1-region on Vibrio cholerae chromosome 2 according to [3] (region arround 461329-461629 Vibrio cholerae O1 biovar eltor str. N16961) 24
ter2Crv CGGTACTTCTTTGATCATCGC qPCR for ter1-region on Vibrio cholerae chromosome 2 according to [3] (region arround 461329-461629 Vibrio cholerae O1 biovar eltor str. N16961) 24
ter2Cprobe CCCTGCTCGCTCATGATGGC HPLC 5'Fam - 3'Tamra qPCR for ter1-region on Vibrio cholerae chromosome 2 according to [3] (region arround 461329-461629 Vibrio cholerae O1 biovar eltor str. N16961) 24
2728013fw CGCAACCCTTATCCTTTGTT qPCR for region 2727638 on Escherichia coli str. K-12 substr. MG1655 complete genome rrsG (16S rRNA), region with high unspecific binnding in ChIP experiments
2728013rv TAAGGGCCATGATGACTTGA qPCR for region 2727638 on Escherichia coli str. K-12 substr. MG1655 complete genome rrsG (16S rRNA), region with high unspecific binnding in ChIP experiments
2728013probe CTCCTTTGAGTTCCCGGCCG HPLC5'Fam - 3'Tamra qPCR for region 2727638 on Escherichia coli str. K-12 substr. MG1655 complete genome rrsG (16S rRNA), region with high unspecific binnding in ChIP experiments
ibpAqPCRfw AGGTAGCCAGAACACCCATC qPCR for region 3865545 on Escherichia coli str. K-12 substr. MG1655 complete genome ibpA, region should give high sigma32 IP
ibpAqPCRrv AAGTCCGCTGATAAGGCTTG qPCR for region 3865545 on Escherichia coli str. K-12 substr. MG1655 complete genome ibpA, region should give high sigma32 IP
ibpAqPCRprobe CGCGTCCTCATCGGCTACGA HPLC5'Fam - 3'Tamra qPCR for region 3865545 on Escherichia coli str. K-12 substr. MG1655 complete genome ibpA, region should give high sigma32 IP


  1. Yamazoe M, Adachi S, Kanaya S, Ohsumi K, and Hiraga S. Sequential binding of SeqA protein to nascent DNA segments at replication forks in synchronized cultures of Escherichia coli. Mol Microbiol. 2005 Jan;55(1):289-98. DOI:10.1111/j.1365-2958.2004.04389.x | PubMed ID:15612935 | HubMed [Yamazoe-2005]
  2. Rasmussen T, Jensen RB, and Skovgaard O. The two chromosomes of Vibrio cholerae are initiated at different time points in the cell cycle. EMBO J. 2007 Jul 11;26(13):3124-31. DOI:10.1038/sj.emboj.7601747 | PubMed ID:17557077 | HubMed [Rasmussen-2007]
  3. Srivastava P and Chattoraj DK. Selective chromosome amplification in Vibrio cholerae. Mol Microbiol. 2007 Nov;66(4):1016-28. DOI:10.1111/j.1365-2958.2007.05973.x | PubMed ID:17944831 | HubMed [chattoray-2007]

All Medline abstracts: PubMed | HubMed