SBB11Ntbk-NikitPatel: Difference between revisions
From OpenWetWare
Jump to navigationJump to search
Nikit Patel (talk | contribs) |
Nikit Patel (talk | contribs) No edit summary |
||
| Line 55: | Line 55: | ||
:- Band in lane 2 from gel (below) confirmed size around 600 bp | :- Band in lane 2 from gel (below) confirmed size around 600 bp | ||
:- Perform [http://openwetware.org/wiki/Template:SBB-Protocols_Zymo1 Regular Zymo Cleanup] | :- Perform [http://openwetware.org/wiki/Template:SBB-Protocols_Zymo1 Regular Zymo Cleanup] | ||
==[[User:Nikit Patel|Nikit Patel]] 14:19, 22 February 2011 (EST)== | |||
''Thought of the day: A shout out to Professor Anderson for redoing our PCRs. We will never forget this.'' | |||
:[[Image:021711-AnalGel2.jpg | 250px]] | :[[Image:021711-AnalGel2.jpg | 250px]] | ||
==[[User:Nikit Patel|Nikit Patel]] 18:17, 18 February 2011 (EST)== | ==[[User:Nikit Patel|Nikit Patel]] 18:17, 18 February 2011 (EST)== | ||
''Thought of the day: Nikit + [http://openwetware.org/ | ''Thought of the day: Nikit + [http://openwetware.org/images/0/0c/Gary_Profile.jpg Gary] = Best SOEing partners!'' | ||
* P_sbp SOEing PCR products | * P_sbp SOEing PCR products | ||
Revision as of 19:19, 22 February 2011
Constructing Basic Parts
Nikit Patel 11:30, 15 February 2011 (EST)
Thought of the day: Did my first PCR after 3 years at Berkeley!
- Create 100uM stock of oligos: P_sbp_inR and SS50r
- Followed Cloning by PCR Protocol:
- - Used construction files below to setup PCR
- - Did first part of SOEing for P_sbp basic part
- - Thermocycler Program: 2K55
Construction of P_sbp BglBrick basic part sbb1124
PCR ss50f/P_sbp_inR on MG1655 (247 bp, gp = A)
PCR P_sbp_inF/ss50r on MG1655 (492 bp, gp = B)
---------------------------------------------------
PCR ss50f/ss50r on A+B (710 bp, EcoRI/BamHI)
Sub into pBjh1601KC-Bca1144 (EcoRI/BamHI, 3131+910, L)
Product is pBjh1601KC-sbb1124 {P_sbp}
---------------------------------------------------
P_sbp_inR Reverse removal of EcoRI site in P_sbp
CAATAAATTGCAGAAGTCATGTAGGCCTG
P_sbp_inF Forward removal of EcoRI site in P_sbp
CAGGCCTACATGACTTCTGCAATTTATTG
ss50f sbp
aaaccGAATTCatgAGATCTgcggtcgttgtgtaggtatccag
ss50r sbp
tttggGGATCCcaacatcagcttcaataccgttg
Part sbb1104 {P_fadL}
PCR ss29f/ss29r on MG1655 gen. (611bp, EcoRI/BamHI)
Sub into pBjh1601KC-Bca1144#5 (EcoRI/BamHI, 3131+910, L)
Product is pBjh1601KC-sbb1104 {P_fadL}
---------------------------------------------------
ss29fForward Cloning of P_fadL aaaccGAATTCatgAGATCTgctttttcagtcagcgccgccag
ss29rReverse Cloning of P_fadL tttggGGATCCgataagtgccactgcgactgcgagagc
Nikit Patel 12:35, 17 February 2011 (EST)
Thought of the day: Is it me or is ADB buffer like magic? It annihilated the gel so fast!
- P_sbp Products A and B
- - Ran preparative gel
- - Lanes 2 and 3 from gel (below) confirmed sizes around 250 and 500 bp respectively
- - Bands were cut
- - Performed Zymo Gel Purification on both A + B
- - Setup and run PCR for SOEing using Zymo Gel Purified DNA as template. (Used 2K55 mode for thermocycler)
- P_fadL Products
- - Ran analytical gel (prepped 2uL DNA + 5uL Dye)
- - Band in lane 2 from gel (below) confirmed size around 600 bp
- - Perform Regular Zymo Cleanup
Nikit Patel 14:19, 22 February 2011 (EST)
Thought of the day: A shout out to Professor Anderson for redoing our PCRs. We will never forget this.
Nikit Patel 18:17, 18 February 2011 (EST)
Thought of the day: Nikit + Gary = Best SOEing partners!
- P_sbp SOEing PCR products