SBB11Ntbk-SuhaniVora: Difference between revisions
Suhani Vora (talk | contribs) No edit summary |
Suhani Vora (talk | contribs) No edit summary |
||
| Line 68: | Line 68: | ||
''Shout out to Chris for hookin' us up with some sweet PCR.'' | ''Shout out to Chris for hookin' us up with some sweet PCR.'' | ||
(Gel cut out by Prof. Anderson, thanks!) | |||
==~~!~~== | |||
Zymo Gel Purification of sbb1121 and sbb1134 using[http://openwetware.org/wiki/Template:SBB-Protocols_Zymo3 Zymo Gel Purification Protocol] | |||
Eluted in 8ul DDW | |||
Happy Birthday [http://openwetware.org/wiki/Image:VM.jpg Vinidhra Mani]!!! | |||
Revision as of 18:57, 24 February 2011
~~!~~
Suhani Vora 14:08, 15 February 2011 (EST)
Today we set up PCR reactions for our promoter parts.
-Resuspended oligos PmalK_R and SV_06 to 100 uM.
-Diluted primers to 10 uM.
-Set up PCR for cloning using Cloning by PCR Protocol
1. P_malk
2. P_nlpA
3. P_rfaQ
Thermocycler Program: 2K55
Construction Files:
PCR ss61f/P_malKR on E. coli MG1655 gDNA (525 bp, EcoRI/BamHI)
Sub into pBjh1601KC-Bca1144 (EcoRI/BamHI, 3131+910 bp, L)
Product is pBjh1601KC-sbb1134 {P_malK}
----------------------------------------------------------------
ss61f BglBrick basic part cloning of lamB promoter AAACCGAATTCATGAGATCTATGCGGATAATGCGAGGATGCGTGCACCTG
P_malkR BglBrick basic part cloning of lamB promoter CTGATggatccACCTTCATGGATATCGAGATTG
Part sbb1132 {P_nlpA}
PCR ss58r/SV_06 on MG1655 gen. (542bp, EcoRI/BamHI)
Sub into pBjh1601KC-Bca1144#5 (EcoRI/BamHI, 3131+910, L)
Product is pBjh1601KC-sbb1132 {P_nlpA}
------------------------------------------------------
ss58r Forward Cloning of P_nlpA aaaccGAATTCatgAGATCTgcttcccaataattgctctg
SV_06 P_nlpAR (reverse cloning of P_nlpA BglBricks basic part) CTGATGGATCCCCGTAGATGATGTGTTGTCAG
Part sbb1121 {P_rfaQ}
PCR ss47r/ss47f on MG1655 gen. (1031bp, EcoRI/BamHI)
Sub into pBjh1601KC-Bca1144#5 (EcoRI/BamHI, 3131+910, L)
Product is pBjh1601KC-sbb1121 {P_rfaQ}
------------------------------------------------------
ss47fReverse Cloning of P_rfaQ tttggGGATCCttttcagacaaaatagggatggtgtcctg
ss47rForward Cloning of P_rfaQ aaaccGAATTCatgAGATCTattttacgtttatgtagcgccgcaatcagg
Suhani Vora 13:24, 17 February 2011 (EST)
Ran PCR samples of P_malK, P_nlpA, P_rfaQ on analytical gel.
2ul Sample + 5 uL Loading Dye Buffer
Sample 1 [Lane 3]: P_malK (525 bp)
Sample 2 [Lane 4]: P_nlpA (542 bp)
Sample 3 [Lane 5]: P_rfaQ (1031 bp)
Cleaned with Zymo Cleanup : May have used wrong buffer.
All PCR products for the class were thrown out, re-done by Prof. Anderson.
Suhani Vora 13:37, 22 February 2011 (EST)
P_nlpA PCR failed yesterday. Will have to move on without that part.
EcoRI/BamHI Digest of P_rfaQ (sbb1121) and P_malK (sbb1134) using Using EcoRI/BamHI Digest Protocol
Place in thermocycler at 37 deg for 1 hr.
Gel E Lane 3: sbb1121 (P_rfaQ) [1031 bp]
Gel E Lane 4: sbb1134 (P_malK) [525 bp]
Shout out to Chris for hookin' us up with some sweet PCR.
(Gel cut out by Prof. Anderson, thanks!)
~~!~~
Zymo Gel Purification of sbb1121 and sbb1134 usingZymo Gel Purification Protocol
Eluted in 8ul DDW
Happy Birthday Vinidhra Mani!!!