SBB11Ntbk-SuhaniVora: Difference between revisions

From OpenWetWare
Jump to navigationJump to search
No edit summary
No edit summary
Line 68: Line 68:


''Shout out to Chris for hookin' us up with some sweet PCR.''
''Shout out to Chris for hookin' us up with some sweet PCR.''
(Gel cut out by Prof. Anderson, thanks!)
==~~!~~==
Zymo Gel Purification of sbb1121 and sbb1134 using[http://openwetware.org/wiki/Template:SBB-Protocols_Zymo3 Zymo Gel Purification Protocol]
Eluted in 8ul DDW
Happy Birthday [http://openwetware.org/wiki/Image:VM.jpg Vinidhra Mani]!!!

Revision as of 18:57, 24 February 2011

~~!~~

Suhani Vora 14:08, 15 February 2011 (EST)

Today we set up PCR reactions for our promoter parts.
-Resuspended oligos PmalK_R and SV_06 to 100 uM.
-Diluted primers to 10 uM.
-Set up PCR for cloning using Cloning by PCR Protocol
1. P_malk
2. P_nlpA
3. P_rfaQ
Thermocycler Program: 2K55

Construction Files:

PCR ss61f/P_malKR on E. coli MG1655 gDNA  (525 bp, EcoRI/BamHI)
Sub into pBjh1601KC-Bca1144               (EcoRI/BamHI, 3131+910 bp, L) 
Product is pBjh1601KC-sbb1134             {P_malK}
----------------------------------------------------------------
ss61f	BglBrick basic part cloning of lamB promoter	AAACCGAATTCATGAGATCTATGCGGATAATGCGAGGATGCGTGCACCTG
P_malkR	BglBrick basic part cloning of lamB promoter	CTGATggatccACCTTCATGGATATCGAGATTG

Part sbb1132                       {P_nlpA}
PCR ss58r/SV_06 on MG1655 gen.              (542bp, EcoRI/BamHI)
Sub into pBjh1601KC-Bca1144#5                 (EcoRI/BamHI, 3131+910, L)
Product is pBjh1601KC-sbb1132                       {P_nlpA}
------------------------------------------------------
ss58r	Forward Cloning of P_nlpA                                 aaaccGAATTCatgAGATCTgcttcccaataattgctctg
SV_06	P_nlpAR  (reverse cloning of P_nlpA BglBricks basic part) CTGATGGATCCCCGTAGATGATGTGTTGTCAG

Part sbb1121                       {P_rfaQ}
PCR ss47r/ss47f on MG1655 gen.                (1031bp, EcoRI/BamHI)
Sub into pBjh1601KC-Bca1144#5                 (EcoRI/BamHI, 3131+910, L)
Product is pBjh1601KC-sbb1121                       {P_rfaQ}
------------------------------------------------------
ss47fReverse Cloning of P_rfaQ     tttggGGATCCttttcagacaaaatagggatggtgtcctg
ss47rForward Cloning of P_rfaQ     aaaccGAATTCatgAGATCTattttacgtttatgtagcgccgcaatcagg

Suhani Vora 13:24, 17 February 2011 (EST)

Ran PCR samples of P_malK, P_nlpA, P_rfaQ on analytical gel.

2ul Sample + 5 uL Loading Dye Buffer

Sample 1 [Lane 3]: P_malK (525 bp)
Sample 2 [Lane 4]: P_nlpA (542 bp)
Sample 3 [Lane 5]: P_rfaQ (1031 bp)

Cleaned with Zymo Cleanup : May have used wrong buffer.

All PCR products for the class were thrown out, re-done by Prof. Anderson.

Suhani Vora 13:37, 22 February 2011 (EST)

P_nlpA PCR failed yesterday. Will have to move on without that part.

EcoRI/BamHI Digest of P_rfaQ (sbb1121) and P_malK (sbb1134) using Using EcoRI/BamHI Digest Protocol

Place in thermocycler at 37 deg for 1 hr.

Gel E Lane 3: sbb1121 (P_rfaQ) [1031 bp]
Gel E Lane 4: sbb1134 (P_malK) [525 bp]

Shout out to Chris for hookin' us up with some sweet PCR.

(Gel cut out by Prof. Anderson, thanks!)

~~!~~

Zymo Gel Purification of sbb1121 and sbb1134 usingZymo Gel Purification Protocol

Eluted in 8ul DDW

Happy Birthday Vinidhra Mani!!!