840:153g:Projects/project19/2011/11/15: Difference between revisions

From OpenWetWare
Jump to navigationJump to search
Autocreate 2011/11/15 Entry for 840:153g:Projects/project19
 
No edit summary
Line 1: Line 1:
We will be cloning the Cstps1 Gene from Citrus Sinensis.  This gene is responsible for producing an enzyme which reacts with FPP (farnesyl pyrophosphate)to produce valencene, the major component of the citrus scent of oranges.  The gene was located on the Genbank of the NCBI website with the accession number AF441124.1.  The gene contains 1647 bp without introns.  We will design 2 different sets of primers.  One set will be compatible with the biobrick ends and the other set will not.  After the gene is cloned, it will be transformed into E. coli, in a select media containing FPP.  If we are able to smell the oranges, our research was successful. We may also develop another way to test for the scent if it is not evident that it is there right away.
Today we ran a gel from our PCR products.  We then cut out bands and purified them with a Gel Purification Kit.
 
 
Our primers are:
19_orange1_F: atgtcgtctggagaaacatt
 
19_orange2_R:  tcaaaatggaacgtggtctc
 
19_orange1a_F: gaattcgcggccgcttctagatgtcgtctggagaaacatt
 
19_orange2a_R: tactagtagcggccgctgcagtcaaaatggaacgtggtctc
 
Our promoters to test are:
BBa_I13453
BBa_I0500
BBa_I765001
 
Accession number to the mRNA of the gene:
AF441124

Revision as of 20:18, 17 November 2011

Today we ran a gel from our PCR products. We then cut out bands and purified them with a Gel Purification Kit.