IGEM:Harvard/2006/DNA nanostructures/Notebook/2006-8-7: Difference between revisions

From OpenWetWare
Jump to navigationJump to search
Line 13: Line 13:
Mix together, in order:
Mix together, in order:
* 998 fmols (14.0 ng) ligand DNA (MW = 14,027 Da [http://www.changbioscience.com/genetics/mw.html]) = 1 {{ul}} 1 {{um}}
* 998 fmols (14.0 ng) ligand DNA (MW = 14,027 Da [http://www.changbioscience.com/genetics/mw.html]) = 1 {{ul}} 1 {{um}}
** 45 nt: TAAAGAAACTCGGATGCGCCACGCAGGATTGGGGCGCGCCCGCGG
* 1 pmol (11.3 ng) attachment DNA c4.0.6.1.ob (MW = 11,259.3 Da) = 1 {{ul}} 1 {{um}}
* 1 pmol (11.3 ng) attachment DNA c4.0.6.1.ob (MW = 11,259.3 Da) = 1 {{ul}} 1 {{um}}
** 37 nt: AAGGCTCCGATCTATTTTTTTTCCGCGGGCGCGCCCC
* 2 {{ul}} 10x BSA
* 2 {{ul}} 10x BSA
* 2 {{ul}} 10x NEBuffer 4 [http://www.neb.com/nebecomm/products/productR0558.asp]
* 2 {{ul}} 10x NEBuffer 4 [http://www.neb.com/nebecomm/products/productR0558.asp]
Line 26: Line 28:


Incubate samples at 37{{c}} for specified time. Run on an 18% PA gel.
Incubate samples at 37{{c}} for specified time. Run on an 18% PA gel.
* expected ss sizes
** 34 nt, 11 nt (digested ligand)
** 29 nt, 8 nt (digested attachment DNA)
** 45 nt (undigested ligand)
** 37 nt (undigested attachment DNA)

Revision as of 18:37, 7 August 2006

AscI digestion protocol proposal

adopted from Wednesday's proposal

Initial test, just oligos

Start by trying to digest ~25 ng DNA.

1 unit = enough enzyme to digest 1 μg DNA at 37[[:Category:{{{1}}}|{{{1}}}]] in 1 h in a total reaction volume of 50 μL [1]

  • = enough enzyme to digest 5 μg DNA at 37[[:Category:{{{1}}}|{{{1}}}]] in 1 h in a total reaction volume of 10 μL
  • = enough enzyme to digest 1 μg DNA at 37[[:Category:{{{1}}}|{{{1}}}]] in 12 min. in a total reaction volume of 10 μL

Mix together, in order:

  • 998 fmols (14.0 ng) ligand DNA (MW = 14,027 Da [2]) = 1 μL 1 μM
    • 45 nt: TAAAGAAACTCGGATGCGCCACGCAGGATTGGGGCGCGCCCGCGG
  • 1 pmol (11.3 ng) attachment DNA c4.0.6.1.ob (MW = 11,259.3 Da) = 1 μL 1 μM
    • 37 nt: AAGGCTCCGATCTATTTTTTTTCCGCGGGCGCGCCCC
  • 2 μL 10x BSA
  • 2 μL 10x NEBuffer 4 [3]
  • 25 ng DNA should require 0.025 units (25 milliunits) for a 12-minute digest. Do the following trials:
    • no enzyme, 12-minute digest
    • no enzyme, 24-minute digest
    • 50 milliunits (1 μL 50 milliunits/μL), 12-minute digest
    • 500 milliunits (1 μL 500 milliunits/μL), 12-minute digest
    • 50 milliunits (1 μL 50 milliunits/μL), 24-minute digest
    • 500 milliunits (1 μL 500 milliunits/μL), 24-minute digest
  • water to 20 μL

Incubate samples at 37[[:Category:{{{1}}}|{{{1}}}]] for specified time. Run on an 18% PA gel.

  • expected ss sizes
    • 34 nt, 11 nt (digested ligand)
    • 29 nt, 8 nt (digested attachment DNA)
    • 45 nt (undigested ligand)
    • 37 nt (undigested attachment DNA)