Template:SBB12 part sbb1203: Difference between revisions

From OpenWetWare
Jump to navigationJump to search
JCAnderson (talk | contribs)
No edit summary
JCAnderson (talk | contribs)
No edit summary
 
Line 11: Line 11:
===Construction File===
===Construction File===
<pre>
<pre>
PCA1 on o1/o2/o3   (pca1)
PCA1 on o1/o2/o3         (pca1)
PCA2 with o1/o2 on pca1  (bp, pca2)
PCA2 with o1/o2 on pca1  (142 bp, pca2)
Digest pca2       (NheI/BamHI, L, 1203dig)
Digest pca2               (NheI/BamHI, L, 1203dig)
Digest pBca9525-Bca1834 (NheI/BamHI, L, vectdig)
Digest pBca9525-Bca1834   (NheI/BamHI, L, vectdig)
Ligate 1203dig + vectdig, product is pBca9525-sbb1203
Ligate 1203dig + vectdig, product is pBca9525-sbb1203
----
----

Latest revision as of 00:59, 14 February 2012

Partname:     sbb1203
Featurename:  lz_WGLK
Genename:     leucine zipper variant
Source:       Synthetic, see PMID:12459719 

This part encodes a leucine zipper

We will be using a set of leucine zippers as homodimer domains. In total, we'll have 8 of them all with different Kd's for homodimerization. However, the sequences only differ at the same 4 amino acid sites. This will allow us to test whether the activation of ToxR is dependent on the Kd of the homodimer that is attached to it. These sequences are entirely synthetic, but all should encode the following peptide:

VKELEDKNEELLS XX YH XX NEVARLKKLVGERGGC*

Where the x's are the amino acids I tell you. So, if I gave you the lz_IILK zipper to make, the peptide you should encode is: VKELEDKNEELLSIIYHLKNEVARLKKLVGERGGC*

Here is an example of what your trying to make pBca9525-sbb1230.

This part encodes a homodimer domain

You are going to put the homodimer on the C-terminus of a truncated ToxR. For this part, you're going to go off BioBricks. Kindov. Your final product will be a BioBrick, but you are going to use an ad hoc procedure to create it. You should examine this illustration which refers to two sequences: pBca9525-Bca1834 and pBca9525-Bca1839. The important thing here is that you think through the translation frame of the final product, and make sure that you add some linker between your sequence and the sequence 5' to it. You should also remove the start methionine from you homodimer, unless your project description explicitly says not to. You should include the stop codon.

The product of your construction file should resemble pBca9525-Bca1839 in terms of it encoding a full expression cassette containing a ToxR fusion protein with your designed feature. If you were given part sbb1293, your product would be called pBca9525-sbb1293.


Construction File

PCA1 on o1/o2/o3          (pca1)
PCA2 with o1/o2 on pca1   (142 bp, pca2)
Digest pca2               (NheI/BamHI, L, 1203dig)
Digest pBca9525-Bca1834   (NheI/BamHI, L, vectdig)
Ligate 1203dig + vectdig, product is pBca9525-sbb1203
----
>o1	
CCATAgctagcGGCAGTGGATCTGTTAAAGAACTGGAAGACAAAAACGAAGAACTGCTGAGT
>o2	
CAGTAGGATCCTTAGCAGCCGCCACGTTCGCCAACCAGTTTTTTCAGACGAGCAACTTCGTT
>o3	
CAAAAACGAAGAACTGCTGAGTTGGGGCTACCACCTGAAGAACGAAGTTGCTCGTCTGA
>pca2
CCATAgctagcGGCAGTGGATCTGTTAAAGAACTGGAAGACAAAAACGAAGAACTGCTGAGTTGGGGCTACCACCTGAAGAACGAAGTTGCTCGTCTGAAAAAACTGGTTGGCGAACGTGGCGGCTGCTAAGGATCCTACTG