Biomod/2012/UTokyo/UT-Komaba/Experiment/Modified Origami: Difference between revisions
Shun Otsubo (talk | contribs) |
Shun Otsubo (talk | contribs) |
||
| Line 37: | Line 37: | ||
=== | ===The design of the DNA tablet=== | ||
Using the three hammerhead structures, we designed the DNA origami. | |||
[[Image:BIOMOD-2012-UTkyo-UTKomaba-design.png]] | |||
==Experiment== | ==Experiment== | ||
Revision as of 16:07, 25 October 2012
<html>
<style type="text/css"> </style>
</html>
Concept

We combine DNA origami and pseudo-hammerhead structure so that, when cover DNAs hybridize to the structure, the hammerhead forms and the surface of the modified origami shows a picture. Therefore, if we can set up the bistable system so that it produces the cover DNAs for different images, we can realize the DNA tablet. The purpose of the experiment is to make sure that the additional single strand necessary for the hammerhead structure DNAs do not disturb during annealing in PCR. We observe the modified DNA origami with cover DNA by AFM.
Method
Pseudo-hammerhead Structure
To make hammerhead structure, we needed to add some DNA sequences to existing staples witch didn't interact with other parts of DNA origami. We made such sequences from the sequence below.

| GGAACCTCAGCCCAACTAACAT |
This sequence is known not to interact with other parts of DNA origami. We made three hammerhead structures from this.
(5' -> 3' direction)
| addition to staple | cover | |
|---|---|---|
| 1 | CTCCAAGGTTT - TTTAGCCCAAC | GAGGTTCCTCGGGTTG |
| 2 | CGACTCCATTT - TTTCCAACTAA | TGGGCTGATGATTGTA |
| 3 | ACCCGACTTTT - TTTACTAACAT | GCTGAGGTGGTTGATT |
The design of the DNA tablet
Using the three hammerhead structures, we designed the DNA origami.
Experiment
October 3rd

We designed the modified origami and annealed them for about an hour in PCR. On the surface of one origami, there are 15 hammerhead structure and 1 hairpin structure. Therefore, we order DNA which composes the structures and replace staple strands of normal origami with them. We drew three lines on the surface by the hammerhead structures, and one line consisted of 5 hammerhead structures. The abstract design of the origami is the picture above.
October 5th
We made modified origami in October 3rd and keep them at the laboratory room temperture.
We observed the modified origami by AFM and we get the clear picture of lines on the surface of the origami.
The three lines on the surface shows the fact that the modified origami which have hammerhead structures was well-done.
Also, the picture below proved that we can observe a hammerhead structure as a dot so that we can draw a picture on the origami surface.
October 25th
The purpose of the experiment is to find out the reason why we could not observe the tablet by AFM in October 24th. To make sure whether we could not observe it because of AFM or not, we made modified origami which we succeeded in October 3rd. We made the modified origami in the same condition as that in October 3rd.

