BME103:T930 Group 9: Difference between revisions
Devraj Patel (talk | contribs) |
Devraj Patel (talk | contribs) |
||
| Line 141: | Line 141: | ||
'''Specific Cancer Marker Detection - The Underlying Technology'''<br> | '''Specific Cancer Marker Detection - The Underlying Technology'''<br> | ||
After studying how the polymerase chain reaction machine works and the results it yields, we have to study how the DNA processed can be used to identify any sort of disease. Specifically, the | After studying how the polymerase chain reaction machine works and the results it yields, we have to study how the DNA processed can be used to identify any sort of disease. Specifically, the rs17879961 cancer-associated sequence will produce a DNA signal because of the single nucleotide variation in its gene code. Based on our study of the rs17879961 cancer-associated sequence, we found that the missense mutation in e gene code yields a positive identification marker for cancer when the a single nucleotide C changes to a single nucleotide T. <br><br> | ||
Original Code:<br> | Original Code:<br> | ||
| Line 149: | Line 149: | ||
GGAAGTGGGTCCTAAAAACTCTTACA['''''T''''']TGCATACATAGAAGATCACAGTGGC<br><br> | GGAAGTGGGTCCTAAAAACTCTTACA['''''T''''']TGCATACATAGAAGATCACAGTGGC<br><br> | ||
When considering scientific detection of the missense mutation itself, we have found that our DNA sequence | When considering scientific detection of the missense mutation itself, we have found that our DNA sequence rs17879961 is related to the condition of Breast and Colorectal Cancer. Therefore, in the case of PCR detection, the sequence for rs17879961 would be copied for by a primer. The primer starts the copying going forward and backward, with the primer that correlate to the strand of DNA; this primer identify the cancer sequence out of the DNA. Then, the patient would have that strand of DNA extracted and prepared for PCR amplification process. This preparation would include the use of primers, taq Polymerase, solution and dNTPs, and other necessary materials. This solution would be inserted into the PCR machine to be heated/cooled/heated. Eventually, the PCR process would yield multiple strands of the DNA that was initially placed and the SNP part that we had identified. A non-cancer DNA sequence would not produce a signal because the nucleotide variation where a primer would replicate DNA would be out of place; therefore, its process of DNA amplification would occur as normal. Only when we have a mutation, can we identify a signal from the DNA (assuming that we are attempting to detect a normal nucleotide sequence).<br><br> | ||
As mentioned previously, we studied that the cancer marker, rs17879961, in the PCR experiment was correlated to the Breast and Colorectal cancer, but to completely understand the extent of this cancer's SNP to the development of cancer, we need to take a look at the statistics that not only follow Baye's Rule, but also provide useful information about the spread of this type of cancer. Based on conditional probabilities from a population diversity in Finland where the tested sample was 180 people, we found that the frequency of this cancer found in Finland was 7.8%. The genotype of this sequence of C/T in this population was 1.1% and the genotype of T/T was found to be 98.9%.<br> | |||
For more infomation, visit http://www.ncbi.nlm.nih.gov/projects/SNP/snp_ref.cgi?rs=17879961.<br><br> | |||
BONUS points: Use a program like Powerpoint, Word, Illustrator, Microsoft Paint, etc. to illustrate how primers bind to the cancer DNA template, and how Taq polymerases amplify the DNA. Screen-captures from the OpenPCR tutorial might be useful. Be sure to credit the source if you borrow images. | BONUS points: Use a program like Powerpoint, Word, Illustrator, Microsoft Paint, etc. to illustrate how primers bind to the cancer DNA template, and how Taq polymerases amplify the DNA. Screen-captures from the OpenPCR tutorial might be useful. Be sure to credit the source if you borrow images. | ||
Revision as of 17:16, 11 November 2012
| Home People Lab Write-Up 1 Lab Write-Up 2 Lab Write-Up 3 Course Logistics For Instructors Photos Wiki Editing Help | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
OUR TEAMLAB 1 WRITE-UPInitial Machine TestingThe Original Design
When we unplugged part 3, the LCD, from part 6, the Open PCR circuit Board, the LCD on the machine turned off and no information appeared on the LCD screen.
Test Run On October 25 2012, we conducted our first test on our open PCR machine. We tested the machine to test the operation functionality. The initial test demonstrated the machine heat sink accuratly controlled and displayed the preprogrammed temperaute determined by the software on the computer. The overall successfullness of the machine was good, however it came with one difficulity, fluctuation of time to complete the preporgrammed cycles.
ProtocolsPolymerase Chain Reaction
Flourimeter Assembly Procedure
How to Open Pictures Using Image J
Research and DevelopmentSpecific Cancer Marker Detection - The Underlying Technology Original Code: Modified Code: (due to SNP) When considering scientific detection of the missense mutation itself, we have found that our DNA sequence rs17879961 is related to the condition of Breast and Colorectal Cancer. Therefore, in the case of PCR detection, the sequence for rs17879961 would be copied for by a primer. The primer starts the copying going forward and backward, with the primer that correlate to the strand of DNA; this primer identify the cancer sequence out of the DNA. Then, the patient would have that strand of DNA extracted and prepared for PCR amplification process. This preparation would include the use of primers, taq Polymerase, solution and dNTPs, and other necessary materials. This solution would be inserted into the PCR machine to be heated/cooled/heated. Eventually, the PCR process would yield multiple strands of the DNA that was initially placed and the SNP part that we had identified. A non-cancer DNA sequence would not produce a signal because the nucleotide variation where a primer would replicate DNA would be out of place; therefore, its process of DNA amplification would occur as normal. Only when we have a mutation, can we identify a signal from the DNA (assuming that we are attempting to detect a normal nucleotide sequence). As mentioned previously, we studied that the cancer marker, rs17879961, in the PCR experiment was correlated to the Breast and Colorectal cancer, but to completely understand the extent of this cancer's SNP to the development of cancer, we need to take a look at the statistics that not only follow Baye's Rule, but also provide useful information about the spread of this type of cancer. Based on conditional probabilities from a population diversity in Finland where the tested sample was 180 people, we found that the frequency of this cancer found in Finland was 7.8%. The genotype of this sequence of C/T in this population was 1.1% and the genotype of T/T was found to be 98.9%. For more infomation, visit http://www.ncbi.nlm.nih.gov/projects/SNP/snp_ref.cgi?rs=17879961. BONUS points: Use a program like Powerpoint, Word, Illustrator, Microsoft Paint, etc. to illustrate how primers bind to the cancer DNA template, and how Taq polymerases amplify the DNA. Screen-captures from the OpenPCR tutorial might be useful. Be sure to credit the source if you borrow images. ![]() ![]()
Results
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||







