BME103:T130 Group 3: Difference between revisions
| Line 48: | Line 48: | ||
'''Polymerase Chain Reaction'''<br> | '''Polymerase Chain Reaction'''<br> | ||
The DNA samples were heated to ninety-five degrees Celsius for three (3) minutes to unzip the two single strands. They were then cooled to fifty-seven degrees Celsius and the primers were attached to their matching sequences. They were then heated back to seventy-two degrees Celsius and polymerase extended the DNA strands by attaching the correct free nucleotides in order on the single strands. <br> | The DNA samples were heated to ninety-five degrees Celsius (95°C) for three (3) minutes to unzip the two single strands. They were then cooled to fifty-seven degrees Celsius (57°C) and the primers were attached to their matching sequences. They were then heated back to seventy-two degrees Celsius (72°C) and polymerase extended the DNA strands by attaching the correct free nucleotides in order on the single strands. <br> | ||
{| {{table}} | {| {{table}} | ||
Revision as of 22:29, 14 November 2012
| Home People Lab Write-Up 1 Lab Write-Up 2 Lab Write-Up 3 Course Logistics For Instructors Photos Wiki Editing Help | |||||||||||||||||||||||||||||||||||||||||||||||||||
OUR TEAMLAB 1 WRITE-UPInitial Machine TestingThe Original Design
Experimenting With the Connections
Test Run (Write the date you first tested Open PCR and your experience(s) with the machine)
ProtocolsPolymerase Chain Reaction
Patient 2
(Add your work from Week 3, Part 2 here)
Research and DevelopmentSpecific Cancer Marker Detection - The Underlying Technology (Add a write-up of the information discussed in Week 3's class) Processes of Thermal Cycling: 1. 95°C – DNA is unzipped Why does a cancer gene produce a positive result and a non-cancer gene gives a negative result? Baye’s Rule is then used to allow understanding of the limitations of the tests.
Primer: AACTCTTACACTCGATACAT
ResultsPositive Test---------------------------------A1---------------------------------A2---------------------------------A3--------------------------------A4---------------- B1--------------------------------------------B2---------------------------------B3---------------------------------B4--------------------------------H2O----------------
| |||||||||||||||||||||||||||||||||||||||||||||||||||





