BME103:T930 Group 12: Difference between revisions
| Line 31: | Line 31: | ||
'''Experimenting With the Connections'''<br> | '''Experimenting With the Connections'''<br> | ||
When we unplugged the LCD plate from the Open PCR circuit board, the display of the machine turned off (it stopped sending data to the display). The circuit board sends electricity through the wires, therefore if | When we unplugged the LCD plate from the Open PCR circuit board, the display of the machine turned off (since it stopped sending data to the display). The circuit board sends electricity through the wires, therefore if the LCD plate is not plugged into the circuit board, it will not work. | ||
When we unplugged the white wire that connects the Open PCR circuit board to the 16 tube PCR block, the machine | When we unplugged the white wire that connects the Open PCR circuit board to the 16 tube PCR block, the machine could not record the temperature. This defeats the whole purpose of the machine since it needs to heat the tubes to the specific temperatures. | ||
Revision as of 00:42, 15 November 2012
| Home People Lab Write-Up 1 Lab Write-Up 2 Lab Write-Up 3 Course Logistics For Instructors Photos Wiki Editing Help | ||||||||||||||||||||||||||||||||||||||||||
OUR TEAM
LAB 1 WRITE-UPInitial Machine TestingThe Original Design Experimenting With the Connections When we unplugged the LCD plate from the Open PCR circuit board, the display of the machine turned off (since it stopped sending data to the display). The circuit board sends electricity through the wires, therefore if the LCD plate is not plugged into the circuit board, it will not work. When we unplugged the white wire that connects the Open PCR circuit board to the 16 tube PCR block, the machine could not record the temperature. This defeats the whole purpose of the machine since it needs to heat the tubes to the specific temperatures.
On October 25, 2012, we experimented with the Open PCR. The experience was not pleasant as the machine took an hour and forty minutes to finish the experiment. The time estimate was also incorrect as it fluctuated. Fortunately, the experiment was a success as the machine finished the testing, revealing whether the DNA contained mutations.
(Write the date you first tested Open PCR and your experience(s) with the machine)
ProtocolsPolymerase Chain Reaction The process of the polymerase chain reaction (PCR) is used to amplify specific sequences of DNA and create thousands to millions of copies. The process depends on thermal cycling, which continually heat and cool the samples in order for DNA polymerase and primers to effectively replicate the specific DNA.
(Add your work from Week 3, Part 2 here)
Research and DevelopmentSpecific Cancer Marker Detection - The Underlying Technology (Add a write-up of the information discussed in Week 3's class) (BONUS points: Use a program like Powerpoint, Word, Illustrator, Microsoft Paint, etc. to illustrate how primers bind to the cancer DNA template, and how Taq polymerases amplify the DNA. Screen-captures from the OpenPCR tutorial might be useful. Be sure to credit the source if you borrow images.)
The process is as follows: •The sample is heated to 95 degrees Celsius to separate strands and expose bases. The r17879961 sample is a cancer causing polymorphism prevalent in homo sapiens. It is located in chromosome 22 and is identified by an allele change of ATT → ACT. This missense causes a residue change of I [Ile] ⇒ T [Thr]. Here is the sequence surrounding the mutation: AACTCTTACAC/TTGCATACAT TTGAGAATGTG/AACGTATGTA To detect this sequence using open PCR, the primers must first be constructed. In this case, the reverse primer is going to be AACTCTTACACTGCATACAT, and the forward primer is going be TGGTATAAGACATTCCTGT, located 200 base pairs to the left and would attach to the opposite strand as the reverse primer. The strand needs to be at least 200 base pairs long so that the DNA may be easier detected if the results are positive. If the sample produces positive results, it means that the r17879961 gene is present, so the primers will bind to this gene, replicating exponentially and producing thousands to millions of copies of DNA. If the sample being tested gives us negative results and does not contain this sequence, there will only be around 30 replicated strands of DNA, rather than millions copies, since the primers won’t bind to the gene. A green fluorescent dye is usually used to identify whether or not the sample is positive or negative. The affected gene is checkpoint kinase 2, and in a study of 180 patients the mutation has been shown to occur in 1.1% of population, while the normal gene occurs in 98.9% of the population. The mutations have been linked most closely to prostate and colorectal cancer, but are also associated with Li-Fraumeni syndrome, breast cancer, sarcomas, and brain tumors. According to a study in Finland, the gene was observed in 7.8% of patients with colorectal cancer, and 5.3% of the healthy population (Kilpivaara et al., 2006). Results
| ||||||||||||||||||||||||||||||||||||||||||





