BME103:T930 Group 12: Difference between revisions
No edit summary |
|||
| Line 102: | Line 102: | ||
Negative Control: Test Tube: 8 | Negative Control: Test Tube: 8 | ||
''The Steps:'' <br> | ''The Steps:'' <br> | ||
| Line 115: | Line 114: | ||
*Final Hold: 4 degrees Celsius | *Final Hold: 4 degrees Celsius | ||
'''Fluorimeter'''<br> | |||
<br> | |||
"Set Up" | |||
<br> | |||
"The Steps" | |||
<br><br> | <br><br> | ||
Revision as of 05:41, 15 November 2012
| Home People Lab Write-Up 1 Lab Write-Up 2 Lab Write-Up 3 Course Logistics For Instructors Photos Wiki Editing Help | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
OUR TEAM
LAB 1 WRITE-UPInitial Machine TestingThe Original Design Experimenting With the Connections When we unplugged the LCD plate from the Open PCR circuit board, the display of the machine turned off (since it stopped sending data to the display). The circuit board sends electricity through the wires, therefore if the LCD plate is not plugged into the circuit board, it will not work. When we unplugged the white wire that connects the Open PCR circuit board to the 16 tube PCR block, the machine could not record the temperature. This defeats the whole purpose of the machine since it needs to heat the tubes to the specific temperatures.
On October 25, 2012, we experimented with the Open PCR. The experience was not pleasant as the machine took an hour and forty minutes to finish the experiment. The time estimate was also incorrect as it fluctuated. Fortunately, the experiment was a success as the machine finished the testing, revealing whether the DNA contained mutations.
(Write the date you first tested Open PCR and your experience(s) with the machine)
ProtocolsPolymerase Chain Reaction The process of the polymerase chain reaction (PCR) is used to amplify specific sequences of DNA and create thousands to millions of copies. The process depends on thermal cycling, which continually heat and cool the samples in order for DNA polymerase and primers to effectively replicate the specific DNA.
Male Patients: Test Tubes: 1-3
Female Patients: Test Tubes: 4-6
Cancer DNA Template: Test Tube: 7 Negative Control: Test Tube: 8 The Steps:
Fluorimeter
Research and DevelopmentSpecific Cancer Marker Detection - The Underlying Technology •Template DNA- the sequence being detected. •Primers- Initiate the start site for DNA replication. •Taq polymerase- an enzyme that grabs bases, and matches them to the DNA strand, replicating the strand. •Magnesium Chloride (MgCl2)- a cofactor that binds to Taq and helps it work more efficiently. • dNTP’s -the individual nucleotides floating in the sample tube that will act as building block subunits to be used by the Taq. The process is as follows: •The sample is heated to 95 degrees Celsius to separate strands and expose the bases. •The primers are added to the sample and it is cooled to 57 degrees Celsius so that the separated DNA strands try to reconnect. The primers will bind to the strands in the phase preventing them from reconnecting. •The sample is then heated to 72 degrees Celsius and Taq enzymes attach and start replication, with the help of magnesium chloride to help the enzymes work more efficiently. •The cycle is repeated many times Here are step-by-step illustrations of how the primer binds to the wanted DNA template, and how the Taq polymerase amplifies the DNA: Images from (http://openpcr.org/use-it/) 5' AACTCTTACAC/TTGCATACAT 3' 3' TTGAGAATGTG/AACGTATGTA 5' To detect this sequence using open PCR, the primers must first be constructed. In this case, the reverse primer would be 5' AACTCTTACACTGCATACAT 3', and the forward primer would be 3' TGGTATAAGACATTCCTGT 5'. The forward primer is located 200 base pairs to the left of the reverse primer, attaching to the opposite strand. The strand needs to be at least 200 base pairs long so that the DNA may be easier detected if the results are positive. If the sample produces positive results, it means that the r17879961 gene is present, so the primers will bind to this gene, replicating exponentially and producing thousands to millions of copies of DNA. If the sample being tested gives us negative results and does not contain this sequence, there will only be around 30 replicated strands of DNA, rather than millions copies since the primers won’t bind to the gene. Bayes Rule The affected gene is checkpoint kinase 2, and in a study of 180 patients the mutation has been shown to occur in 1.1% of population, while the normal gene occurs in 98.9% of the population. The mutations have been linked most closely to prostate and colorectal cancer, but are also associated with Li-Fraumeni syndrome, breast cancer, sarcomas, and brain tumors. According to a study in Finland, the gene was observed in 7.8% of patients with colorectal cancer, and 5.3% of the healthy population (Kilpivaara et al., 2006). Results
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||





