BME103:T130 Group 3 l2: Difference between revisions
| Line 123: | Line 123: | ||
<!--- A description of the diseases and their associated SNP's (include the database reference number and web link) ---> | <!--- A description of the diseases and their associated SNP's (include the database reference number and web link) ---> | ||
Breast Cancer<br> | |||
rs137852571 <Br> | |||
AR – | |||
Reverse Primer: <br> | |||
SNP:5,255,325 <br> | |||
Missense GTG→ATG <br> | |||
V[Val]→M[Met] <Br> | |||
Chromosome X | |||
<br> | |||
| Line 132: | Line 143: | ||
Normal: G mutates into cancer A<br> | |||
CAACTTACACATGGACGACC<bR><Br> | |||
<b>reverse primer:</b><br> | |||
GTTGAATGTGTACCTGCAGG | |||
<br><BR> | |||
<b>Forward primer starts at 5,255,175:</b><br> | |||
AGGGGTGGTGGGGAATTACC | |||
'''Illustration''' | '''Illustration''' | ||
| Line 140: | Line 157: | ||
<!-- ##### DO NOT edit below this line unless you know what you are doing. ##### --> | <!-- ##### DO NOT edit below this line unless you know what you are doing. ##### --> | ||
Revision as of 22:53, 15 November 2012
| Home People Lab Write-Up 1 Lab Write-Up 2 Lab Write-Up 3 Course Logistics For Instructors Photos Wiki Editing Help | |||||||||||
OUR TEAMLAB 2 WRITE-UPThermal Cycler EngineeringOur re-design is based upon the Open PCR system originally designed by Josh Perfetto and Tito Jankowski.
Key Features
Instructions
ProtocolsMaterials
PCR Protocol 1.) Pipet 0.1μL of template DNA, 0.5μL of 10μM forward primer, 0.5μL of 10μM reverse primer, 25.0μL of GoTaq Master Mix, and 23.9μL of dH20 in an Eppendorf tube. All of these items mixed together should create a total volume of 50.0μL. DNA Measurement Protocol Fluorimeter Setup Fluorimeter Measurements ImageJ Instructions Research and DevelopmentBackground on Disease Markers
Breast Cancer
Normal: G mutates into cancer A Illustration
|
|||||||||||





