BME103:T930 Group 13 l2: Difference between revisions
Pete Marple (talk | contribs) |
Pete Marple (talk | contribs) |
||
| Line 32: | Line 32: | ||
'''System Design'''<br> The Heat Sink Fan moves air across the metal sheets to cool down the PCR machine and the samples. The Heat Sink removes heat from the PCR machine to cool down the samples. It does this by conducting heat down to the metal sheets that are located beside the heat sink fan. | '''System Design'''<br> The Heat Sink Fan moves air across the metal sheets to cool down the PCR machine and the samples. The Heat Sink removes heat from the PCR machine to cool down the samples. It does this by conducting heat down to the metal sheets that are located beside the heat sink fan. | ||
'''Key Features'''<br> For the Heat Sink Fan, we want to add a second fan to the PCR machine. The reason for adding an additional fan would be cool the heat sink down more rapidly. We also want to change the heat sink in general by add more surface area to the metal sheets in the center. We would increase the number of sheets vertically, and we would add sheets horizontally | '''Key Features'''<br> For the Heat Sink Fan, we want to add a second fan to the PCR machine. The reason for adding an additional fan would be cool the heat sink down more rapidly. We also want to change the heat sink in general by add more surface area to the metal sheets in the center. We would increase the number of sheets vertically, reducing space between sheets, and we would also add two to three sheets horizontally, to increase the surface area even more. | ||
'''Instructions'''<br> The instructions for assembly or use of the machine would not change. To add the second fan, though, we would have to expand the exterior walls to make room for it. This would make the machine slightly larger, but not change its compact, portable size. | '''Instructions'''<br> The instructions for assembly or use of the machine would not change. To add the second fan, though, we would have to expand the exterior walls to make room for it. This would make the machine slightly larger, but not change its compact, portable size. | ||
Revision as of 03:07, 27 November 2012
| Home People Lab Write-Up 1 Lab Write-Up 2 Lab Write-Up 3 Course Logistics For Instructors Photos Wiki Editing Help | |
THE A TEAMLAB 2 WRITE-UPThermal Cycler EngineeringOur re-design is based upon the Open PCR system originally designed by Josh Perfetto and Tito Jankowski. System Design Key Features Instructions ProtocolsMaterials
PCR Protocol
Research and DevelopmentBackground on Disease Markers
Cystic fibrosis is a disease that can be passed on down genetically along the familial line. The disease causes a build up of thick mucus on the inside of the lungs, digestive tract and other parts of the body. Cystic Fibrosis is the most common chronic lung disease to effect children and young adults and is usually diagnosed by the age of two; however, there are weaker strains of the disease that often go un-diagnosed until the age of 18 or later. The disease is recessive so to suffer the disease one must have the gene from both parents. The disease is life-threatening, the mucus builds up and can eventually suffocate the victim. Around 1 in 29 Caucasians of middle European dissent suffer from cystic fibrosis, this is the most susceptible group to this disease. One such SNP which signals for a susceptibility to Cystic Fibrosis is the [A/G] swap changing the codon from TGG ⇒ TGA. This change has been recorded in two patients suffering from cystic fibrosis the swap occurs at nucleotide 302 in exon 3 converting codon 57 from TGG (trp) to TGA (stop). More information can be found: http://www.ncbi.nlm.nih.gov/projects/SNP/snp_ref.cgi?rs=121909025
The primers must be built around the sequence CGTCTCTAC[T/C]CTATCTCTC with the thymine swapped for the cytosine giving the primers: Reverse primer: 3' CGTCTCTTACTCTATCTCTC 5' Forward primer: 5' AAATATCTGGCTGAGTGTTT 3' These primers are 150 bp apart so as to allow the PCR reaction to occur faster, shortening the 30 seconds required per temperature cycled to 10 seconds per cycle.
| |





