BME103:W930 Group10 l2: Difference between revisions
| Line 91: | Line 91: | ||
<!--- Include the sequences of your forward and reverse primers. Explain why a disease allele will give a PCR product and the non-disease allele will not. ---> | <!--- Include the sequences of your forward and reverse primers. Explain why a disease allele will give a PCR product and the non-disease allele will not. ---> | ||
Forward Primer for Type 2 Diabetes: <br> GGACAGTAGATT[G/T]AAGATACTGATTGTGTTTGCAAACA<br> | |||
Reverse Primer for Type 2 Diabetes: <br> GGGCATGTTTGCAAACACAATCAGTATCTTAATCTACTGTCC <br> | |||
Forward Primer for Insomnia: <br> ACAGCAACCAGAACAACTTTGTGCAC[A/G]ACTGCGTCAATATCACAATCAAGCA <br> | |||
Reverse Primer for Insomnia: <br> | |||
Revision as of 06:08, 28 November 2012
| Home People Lab Write-Up 1 Lab Write-Up 2 Lab Write-Up 3 Course Logistics For Instructors Photos Wiki Editing Help | |
OUR TEAMLAB 2 WRITE-UPThermal Cycler EngineeringOur re-design is based upon the Open PCR system originally designed by Josh Perfetto and Tito Jankowski.
Key Features
ProtocolsMaterials
PCR Protocol
Research and DevelopmentBackground on Disease Markers
| |







