BME103:W930 Group1 l2: Difference between revisions
Kevin M. Chu (talk | contribs) |
|||
| Line 132: | Line 132: | ||
|- | |- | ||
| Total||100.0μL | | Total||100.0μL | ||
|} | |}<br> | ||
'''PCR Protocol''' | '''PCR Protocol''' | ||
| Line 153: | Line 153: | ||
#Then, use another pipette to transfer GoTaq master mix into the DNA/primer mixture.<br> | #Then, use another pipette to transfer GoTaq master mix into the DNA/primer mixture.<br> | ||
#Dilute the contents of the test tube by filling its remainder with deionized water.<br> | #Dilute the contents of the test tube by filling its remainder with deionized water.<br> | ||
#Repeat steps | #Repeat steps 6-9 for each of the seven remaining DNA samples including the positive and negative controls using different pipettes to transfer<br> each substance.<br> | ||
#Place the 8 test tubes including the positive and negative controls into the Open PCR machine, and close the lid and tighten the screw so that it<br> barely touches the tops of the tubes.<br> | #Place the 8 test tubes including the positive and negative controls into the Open PCR machine, and close the lid and tighten the screw so that it<br> barely touches the tops of the tubes.<br> | ||
#Using a fine point Sharpie, label each of the test tubes. Number the experimental DNA samples from 1 to 6, and label the positive and negative<br> controls accordingly.<br> | #Using a fine point Sharpie, label each of the test tubes. Number the experimental DNA samples from 1 to 6, and label the positive and negative<br> controls accordingly.<br> | ||
| Line 168: | Line 168: | ||
#Open the lid of the PCR machine, and remove the 8 samples from the PCR tray. | #Open the lid of the PCR machine, and remove the 8 samples from the PCR tray. | ||
#With the fine point Sharpie, label the transfer | #With the fine point Sharpie, label the transfer pipettes and Eppendorf tubes accordingly to prevent contamination. | ||
#Measure 400mL of Tris buffer into a 500mL graduated cylinder and pour into each of the Eppendorf tubes. | #Measure 400mL of Tris buffer into a 500mL graduated cylinder and pour into each of the Eppendorf tubes. | ||
#Extract each sample with one pipette into an Eppendorf tube that contains 400mL of Tris buffer. Be sure to transfer all of the sample into the tube.<br> Label the Eppendorf tube with the sample number. | #Extract each sample with one pipette into an Eppendorf tube that contains 400mL of Tris buffer. Be sure to transfer all of the sample into the tube.<br> Label the Eppendorf tube with the sample number. | ||
| Line 176: | Line 176: | ||
#Next, unbutton one side of the black box, and lift the flap so that it rests on top of the box. Place the box upside down and position it so that the<br> fluorimeter lies in the center of the box. | #Next, unbutton one side of the black box, and lift the flap so that it rests on top of the box. Place the box upside down and position it so that the<br> fluorimeter lies in the center of the box. | ||
#Turn on the fluorimeter so that a blue light shines. | #Turn on the fluorimeter so that a blue light shines. | ||
#From the labeled Eppendorf tubes containing SYBR green dye, use the corresponding pipette to place two drops adjacent to one another on a glass slide. | #From one of the labeled Eppendorf tubes containing SYBR green dye, use the corresponding pipette to place two drops adjacent to one another on<br> a glass slide. The two drops should combine to form a single larger drop. | ||
#Dull the lights in the room, letting in as little light as possible into the box containing the fluorimeter. | #Dull the lights in the room, letting in as little light as possible into the box containing the fluorimeter. | ||
#On the Smartphone, adjust the following settings | #On the Smartphone, adjust the following settings | ||
| Line 185: | Line 185: | ||
#*Maximize the saturation setting. | #*Maximize the saturation setting. | ||
#*Minimize the contrast setting. | #*Minimize the contrast setting. | ||
#Take an image of the fluorimeter and the drop, and record the image number and DNA sample. If desired, take another photograph of the drop. | #Take an image of the fluorimeter and the drop, and record the image number and DNA sample. If desired, take another photograph of the drop. | ||
#Repeat steps 7,10, and 13 | #Repeat steps 7,10, and 13 for the 9 remaining DNA solutions using a different glass slide for each sample. | ||
#Once you have taken all of the pictures, download them onto the computer. | #Once you have taken all of the pictures, download them onto the computer. | ||
#Right click on the file name of the picture and open with Image J. | #Right click on the file name of the picture and open with Image J. | ||
#In Image J, select | #In Image J, select Analyze > Set Measurements and choose area, integrated density, and mean grey value. | ||
#Select | #Select Image > Color > Split Channels. Three images will appear; choose the one named green. | ||
#Draw an oval around the drop. Then, go to analyze and measure, and record the measurements. | #Draw an oval around the drop. Then, go to analyze and measure, and record the measurements. | ||
#Obtain the background reading by moving the oval over the dark area around the drop, and record the INTDEN and RAWINTDEN. | #Obtain the background reading by moving the oval over the dark area around the drop, and record the INTDEN and RAWINTDEN. | ||
#Repeat steps | #Repeat steps 16-20 for all of the pictures. Make sure each sample lines up with the correct INTDEN measurements. | ||
#Subtract the INTDEN background measurement from the INTDEN drop measurement. | #Subtract the INTDEN background measurement from the INTDEN drop measurement. | ||
#Set the DNA concentration in water to 0μg/mL and the DNA concentration in the calf thymus sample to 2μg/mL. | #Set the DNA concentration in water to 0μg/mL and the DNA concentration in the calf thymus sample to 2μg/mL. | ||
Revision as of 06:49, 28 November 2012
| Home People Lab Write-Up 1 Lab Write-Up 2 Lab Write-Up 3 Course Logistics For Instructors Photos Wiki Editing Help | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
OUR TEAMLAB 2 WRITE-UPThermal Cycler EngineeringOur re-design is based upon the Open PCR system originally designed by Josh Perfetto and Tito Jankowski.
ProtocolsMaterials
Each DNA solution consists of
PCR Protocol
Research and DevelopmentBackground on Disease Markers Heterotaxty, (Hetero-different) (taxy-arrangement), syndrome is the most common birth defect that primary occurs in the heart. This syndrome is caused by the mutated gene, ZIC3. The reference number for this syndrome is rs104894962. This disease can also occur in other organs but it is less likely. With this syndrome, organs that are paired together have a mirror image of each other instead of having their own charcterstics. Other organs can also be arranged in a different order requiring major surgeries to aline the organs correctly. In some cases, organs or body parts may work incorrectly causing irregularity, worse infections, more recovery time, or lack of functioning correctly. This is not the only kind of the Heteotaxy however. As previously stated, the more common defects are located in the heart. Since most of the defects occur at birth, there is a varying type and severity. When the syndrome involves the heart, it is mainly because the heart sits to the right side of the chest instead of the left side. Web Link - http://www.ncbi.nlm.nih.gov/projects/SNP/snp_ref.cgi?rs=104894962
The sequence for the heterotaxy disease allele is CCTACACGCACCCGAGCTCCCTGCGC [A/G] AACACATGAAGGTAATTACCCCTTT, with the mutation occurring at the [A/G] site. When the A gene is expressed, the mutation occurs and heterotaxy is coded. When the G gene is expressed, there is no mutation and the gene expression is normal. Forward primer sequence (position 136,651,203 – 136,651,223, read left-right): TCCCTGCGCAAACACATGAA Reverse primer sequence (200 base pairs to the right, read right-left): TCCCAACTTTGCTCACTCCC A heterotaxy disease allele will show a PCR product because the disease allele will be amplified many times through the course of the chain reaction. Because a non-disease allele will not have a mutated expression of the A gene, it will not yield a PCR product and will instead amplify the healthy allele expression.
Illustration http://www.google.com/imgres?q=specific+amplification+of+heterotaxy&um=1&hl=en&client=safari&sa=N&tbo=d&rls=en&biw=1206&bih=684&tbm=isch&tbnid=3QBwBiTFWqfSZM:&imgrefurl=http://www.ipej.org/0802S/sreeram.htm&docid=7LM9Ij0u5jwLgM&imgurl=http://www.ipej.org/0802S/sreeram3.jpg&w=500&h=590&ei=tp2yUIuGDoPniwKmr4HYCw&zoom=1&iact=rc&dur=445&sig=104840076601863359039&page=1&tbnh=128&tbnw=121&start=0&ndsp=26&ved=1t:429,r:4,s:0,i:99&tx=59&ty=47 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||




