BME103 s2013:T900 Group9 L3: Difference between revisions
Aimen Vanood (talk | contribs) |
Aimen Vanood (talk | contribs) |
||
| Line 253: | Line 253: | ||
'''Our primers address the following design needs''' | '''Our primers address the following design needs''' | ||
* These primers bind to the cancer gene, amplifying a mutated sequence. Due to this, | * These primers bind to the cancer gene, amplifying a mutated sequence. Due to this, the presence of cancer is easy to detect, increasing the efficiency of the PCR process. What is more, this results in more precise results, because annealing will only occur if cancer is present. | ||
Revision as of 01:00, 16 April 2013
| Home People Lab Write-Up 1 Lab Write-Up 2 Lab Write-Up 3 Course Logistics For Instructors Photos Wiki Editing Help | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
OUR TEAM
LAB 3 WRITE-UPOriginal System: PCR ResultsPCR Test Results
* Ave. INTDEN = Average of ImageJ integrated density values from three Fluorimeter images
Bayes Theorem equation: P(A|B) = P(B|A) * P(A) / P(B)
Calculation 3: The probability that the patient will develop cancer, given a cancer DNA sequence.
New System: Design StrategyWe concluded that a good system Must Have:
New System: Machine/ Device EngineeringSYSTEM DESIGN
KEY FEATURES We chose to include these new features
[OR] We chose keep the devices the same as the original system
INSTRUCTIONS
New System: ProtocolsDESIGN We chose to include these new approaches/ features
[OR] We chose keep the protocols the same as the original system
New System: Research and DevelopmentBACKGROUND CHEK2 gene stands for Checkpoint Kinase 2 and is plays a role in cancer. This gene is a protein kinase. A protein kinase is involved in the phosphorylation of proteins. In other words, they add phosphate groups to proteins in order to regulate cellular pathways. The CHEK2 gene specifically is associated with DNA repair. When DNA is damaged, the CHEK2 gene is triggered. The protein that this gene encodes is involved in tumor suppression. Thus, when a damaged, the protein begins to phosphorylate in a way that prevents the occurrence of mitosis. Thus, the damaged DNA is not replicated. However, a mutation or polymorphism of the CHEK2 gene results in the improper prevention of DNA replication. This is because, without this gene, the damaged DNA-containing cells do not undergo apoptosis, or programmed cell death. Thus, the mutated DNA is replicated, causing an increase in susceptibility of cancer.
An SNP, or single nucleotide polymorphism, occurs when a single nucleotide in a gene is changed, resulting in a change in sequence of the replicated DNA. An example of this can be seen in CHEK2. Take for instance the normal allele ATT. An polymorphism of this allele is ACT. This SNP causes a change in the complementary DNA strand. Instead of having an allele of TAA, the complementary strand would have TGA instead. This small mutation in DNA if, amplified repeatedly in the body, can result in cancer.
DESIGN
This new system for Polymerase Chain Reaction, PCR, will amplify the cancer-associated DNA in order to more easily observe the presence of cancer in a patient. The primers for this will focus on the ATT-ACT mutation, amplifying the sequence with the single nucleotide polymorphism. The cancer allele forward primer will be: [TTGAGAATGTCACGTATGTAT]. Notice that the mutation is in bold. Similarly, the cancer allele reverse primer will be [AACTCTTACAGTGCATACATA]. The mutation in the complementary strand is indicated in bold as well.
Due to the fact that these primers are designed to bind to DNA strands with the cancer mutation, a product will only form if the patient has the disease. For example, the normal allele, ATT, will not bind to the reverse primer because its complement is TAA, while this primer's is AGT. Primer annealing only occurs in accordance to the complementary base pairing rules of DNA.
Our primers address the following design needs
New System: Software[THIS SECTION IS OPTIONAL. If your team has creative ideas for new software, and new software is a key component included in your new protocols, R&D, or machine design, you may describe it here. You will not receive bonus points, but a solid effort may raise your overall page layout points. If you decide not to propose new software, please delete this entire section, including the ==New System: Software== header.]
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||

