BME103 s2013:T900 Group4 L3: Difference between revisions
Anna Essex (talk | contribs) |
|||
| Line 28: | Line 28: | ||
{| {{table}} | {| {{table}} | ||
|- | |- | ||
| Sample Name || Ave. INTDEN* || Calculated μg/mL || Conclusion (pos/neg) | | Sample Name || Ave. INTDEN* || Calculated (μg/mL) || Conclusion (pos/neg) | ||
|- | |- | ||
| Positive Control || 1,450,385 || | | Positive Control || 1,450,385 || 1.60 || N/A | ||
|- | |- | ||
| Negative Control || 488,789 || | | Negative Control || 488,789 || 0.18 || N/A | ||
|- | |- | ||
| Tube Label: B2 Patient ID: ____ rep 1 || 709,603 || | | Tube Label: B2 Patient ID: ____ rep 1 || 709,603 || 0.51 || pos | ||
|- | |- | ||
| Tube Label: C2 Patient ID: ____ rep 2 || 642,405 || | | Tube Label: C2 Patient ID: ____ rep 2 || 642,405 || 0.41 || pos | ||
|- | |- | ||
| Tube Label: D2 Patient ID: ____ rep 3 || 417,721 || | | Tube Label: D2 Patient ID: ____ rep 3 || 417,721 || 0.07 || neg | ||
|- | |- | ||
| Tube Label: B1 Patient ID: ____ rep 1 || 450,174 || | | Tube Label: B1 Patient ID: ____ rep 1 || 450,174 || 0.12 || neg | ||
|- | |- | ||
| Tube Label: C1 Patient ID: ____ rep 2 || | | Tube Label: C1 Patient ID: ____ rep 2 || 387,850 || 0.03 || neg | ||
|- | |- | ||
| Tube Label: D1 Patient ID: ____ rep 3 || 376,360 || | | Tube Label: D1 Patient ID: ____ rep 3 || 376,360 || 0.01 || neg | ||
|} | |} | ||
<nowiki>* Ave. INTDEN = Average of ImageJ integrated density values from three Fluorimeter images</nowiki> | <nowiki>* Ave. INTDEN = Average of ImageJ integrated density values from three Fluorimeter images</nowiki> | ||
Revision as of 07:29, 16 April 2013
| Home People Lab Write-Up 1 Lab Write-Up 2 Lab Write-Up 3 Course Logistics For Instructors Photos Wiki Editing Help | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
OUR TEAM
LAB 3 WRITE-UPOriginal System: PCR ResultsPCR Test Results
* Ave. INTDEN = Average of ImageJ integrated density values from three Fluorimeter images
Bayes Theorem equation: P(A|B) = P(B|A) * P(A) / P(B)
Calculation 3: The probability that the patient will develop cancer, given a cancer DNA sequence.
New System: Design StrategyWe concluded that a good system Must Have: - Result easy to determine. - Simple OpenPCR Software: The OpenPCR Software shoulder be simple and easy to use and that would help lab experiments done faster, rather than the need to spend extra time to figure out how the software works. We concluded that we would Want a good system to have: - Low cost: OpenPCR $599 Fluorimeter $300. A low cost material would help since there is always a limited budget for the research experiment. This would allow us to buy more OpenPCR and fluorimeter and create more data results in the same amount of time. Phone camera should not be easily moveable when played in front of the fluorimeter. Phone camera adjustment can be time consuming and not setting it in the correct position/distance results data error.
- Troublesome USB Connectivity. USB connectivity should function well in order for OpenPCR machine to work. - Casing = fire hazard. High temperature with PCR can be dangerous.
We concluded that a good system Should Avoid: - Avoid slow amplification. - Hard to adjust phone/ fluorimeter. The phone can be easily moved by accident, which requires readjustment between the phone and the fluorimeter.
New System: Machine/ Device EngineeringSYSTEM DESIGN
KEY FEATURES
Step 1: Connect the base to the fluorimeter.
New System: ProtocolsDESIGN
MATERIALS
New System: Research and DevelopmentBACKGROUND
DESIGN
GGAAGTGGGTCCTAAAAACTCTTACA[C/T]TGCATACATAGAAGATCACAGTGGC
New System: Software[THIS SECTION IS OPTIONAL. If your team has creative ideas for new software, and new software is a key component included in your new protocols, R&D, or machine design, you may describe it here. You will not receive bonus points, but a solid effort may raise your overall page layout points. If you decide not to propose new software, please delete this entire section, including the ==New System: Software== header.]
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||


