BME103 s2013:T900 Group5 L3: Difference between revisions
| Line 143: | Line 143: | ||
<!-- If your team decided to change the PCR and/or the Fluorimeter imaging protocols, summarize the new approaches/ features here and delete the '''We chose keep the protocols the same as the original system''' section. --> | <!-- If your team decided to change the PCR and/or the Fluorimeter imaging protocols, summarize the new approaches/ features here and delete the '''We chose keep the protocols the same as the original system''' section. --> | ||
'''We chose to include these new approaches/ features''' | '''We chose to include these new approaches/ features''' | ||
* | * Plastic case - PCRs are normally found in a lab setting where safety is a big issue. Rather that having a wooden shield which is very flammable, the new shield will be be made out of plastic which will make it safer and possibly more cost efficient. | ||
* | * Solar power battery - the new battery will be more cost efficient, collect more power and will be more sustainable. | ||
* | * Plug inlet - the plug inlet will allow the solar battery plug to go into the PCR and will use the energy that is provided by the battery to be used efficiently. | ||
| Line 164: | Line 157: | ||
* '''PCR Protocol''' | * '''PCR Protocol''' | ||
Thermal Cycler Program | |||
Stage 1 | |||
95°C for 3 minutes | |||
Stage 2 | |||
35 cycles for each of the steps, each cycle will last for 30 seconds | |||
1)95°C | |||
2)57°C | |||
3)72°C | |||
Stage 3 | |||
Final Hold at 4°C | |||
* '''DNA Sample Set-up Procedure''' | |||
Step 1 | |||
Insert fully charged battery in to PCR | |||
Step 2 | |||
Prepare PCR Reaction Mix and DNA sample solutions | |||
Step 3 | |||
Using a pipette, add 50μL of the DNA solutions into a labeled tube (tube should correspond with the solution) | |||
Step 4 | |||
Place tubes in the PCR | |||
Step5 | |||
Run the PCR program | |||
<br><br> | <br><br> | ||
Revision as of 05:53, 17 April 2013
| Home People Lab Write-Up 1 Lab Write-Up 2 Lab Write-Up 3 Course Logistics For Instructors Photos Wiki Editing Help | |||||||||||||||||||||||||||||||||||||
OUR TEAMLAB 3 WRITE-UPOriginal System: PCR ResultsPCR Test Results
* Ave. INTDEN = Average of ImageJ integrated density values from three Fluorimeter images
Bayes Theorem is an equation in probability theory and statistics that relates inverse representations of probabilities concerning two events, or rather, it expresses a degree of change when accounting for evidence. Bayes Theorem is represented as follows: P(A|B) = P(B|A) * P(A) / P(B) Which can be read as the probability of A given B = (the probability of B given A * the probability of A) / the probability of B This information will be utilized to determine various probabilities listed below when accounting for the positive/negative values determined by the entire class as well as an outside document listing the actual yes/no cancer diagnosis
New System: Design StrategyWe concluded that a good system "Must Have":
We concluded that a good system Should Avoid:
New System: Machine/ Device EngineeringRather than consuming loads amount of energy with the PCR's technology, our new PCR will be solar battery powered. SYSTEM DESIGN http://i47.tinypic.com/65tt9e.jpg
INSTRUCTIONS
New System: ProtocolsDESIGN We chose to include these new approaches/ features
MATERIALS
PROTOCOLS
Thermal Cycler Program Stage 1 95°C for 3 minutes Stage 2 35 cycles for each of the steps, each cycle will last for 30 seconds 1)95°C 2)57°C 3)72°C Stage 3 Final Hold at 4°C
Step 1 Insert fully charged battery in to PCR Step 2 Prepare PCR Reaction Mix and DNA sample solutions Step 3 Using a pipette, add 50μL of the DNA solutions into a labeled tube (tube should correspond with the solution) Step 4 Place tubes in the PCR Step5 Run the PCR program
New System: Research and DevelopmentBACKGROUND Polymerase chain reaction is the process of amplifying a strand of DNA from a DNA template strand. From here the scientist is capable of amplifying any specific gene they choose. In this research we are targeting the single nucleotide polymorphism that is rs1787996, which contains a single nucleotide variation or SNV. The CHEK2 gene is essentially a gene that is capable of coding for susceptibility to breast cancer. The relation to SNP is that it is essentially a variation of the CHEK 2 gene that is present within humans, or Homo sapiens. The cancer-related function of the gene is that it essentially changes the base Thymine to Cytosine, changing the normal allele ATT to ACT, which is the cancer related allele.
Primers for PCR Cancer allele forward primer: 5' TATGTATGCACTGTAAGAGTT Cancer allele reverse prime: 5' CTAGGAGAGCTGGTAATTTGG A disease allele will give a PCR product because the primer associated with the process will identify the sequences that will code for cancer. From there the primer will allow for nucleotide bases to be placed in a reverse sequence from the template DNA. Essentially this will continuously amplify the cancerous DNA gene while the PCR process is in effect.
New System: Software[THIS SECTION IS OPTIONAL. If your team has creative ideas for new software, and new software is a key component included in your new protocols, R&D, or machine design, you may describe it here. You will not receive bonus points, but a solid effort may raise your overall page layout points. If you decide not to propose new software, please delete this entire section, including the ==New System: Software== header.]
|
|||||||||||||||||||||||||||||||||||||
