SBB13Ntbk-Robert Chen: Difference between revisions
Robert Chen (talk | contribs) No edit summary |
Robert Chen (talk | contribs) No edit summary |
||
| Line 343: | Line 343: | ||
9. Add 100uL of 2YT, let shake in the 37 degree incubator for 1 hour | 9. Add 100uL of 2YT, let shake in the 37 degree incubator for 1 hour | ||
10. Plate 70+ uL on selective antibiotics, let incubate at 37 degrees overnight</pre> | 10. Plate 70+ uL on selective antibiotics, let incubate at 37 degrees overnight</pre> | ||
==[[User:Robert Chen|Robert Chen]] 14:06, 25 April 2013 (EDT)== | |||
CCOMT worked!! Chris picked our colonies, and we want to: 1) Miniprep 2) Restriction map with BsaI | |||
''Mini-Prep'' | |||
<pre>Pellet 2 mL saturated culture by spinning full speed, 30 seconds in a 2mL Microcentrifuge tube. | |||
Dump supernatant | |||
Add 250uL of P1 buffer into each tube. Resuspend the cells thoroughly | |||
Add 250uL of P2 buffer (a base that denatures everything and causes cells to lyse). Gently mix up and down. Solution should become clearer. | |||
Add 350uL of N3 buffer (an acid of pH ~5 that causes cell junk - including protein and chromosomal DNA - to precipitate, and leaves plasmids and other small molecules in solution). Slowly invert a few times, then shake. | |||
Spin in centrifuge at top speed for 5 minutes. | |||
Label blue columns with an alcohol-resistant lab pen. | |||
Pour liquid into columns, and place the columns into the centrifuge. Spin at full speed for 15 seconds. | |||
Dump liquid out of the collectors under the columns (the DNA should be stuck to the white resin) | |||
Wash each column with 500 uL of PB buffer. | |||
Spin in centrifuge at full speed for 15 seconds, then flick out the liquid again. | |||
Wash with 750uL of PE buffer (washes the salts off the resins). | |||
Spin in centrifuge at full speed for 15 seconds and flick out liquid again. | |||
Spin in centrifuge at full speed for 90 sec to dry off all water and ethanol. | |||
Label new Microcentrifuge tubes and put columns in them. | |||
Elute them by adding 50uL of water down the middle of the column (don't let it stick to the sides). | |||
Spin in centrifuge at top speed for 30 seconds. | |||
Take out columns and cap the tubes. | |||
Clean up - note the P1 buffer is stored at 4degC and all the rest at room temperature.</pre> | |||
''BsaI digest'' | |||
<pre>6.5uL H2O | |||
2uL Plasmid DNA | |||
1uL NEB4 | |||
0.5uL BsaI | |||
Thermocycle for 30 minutes</pre> | |||
Latest revision as of 18:06, 25 April 2013
2013 03 06: Designed oligos for PCA1 on CCOMT-1
CCOMT1_Synthon PCA for oligos 1-11, 13-14, 16 (407bp, PCA1_pdt) PCA for oligos 12,15, PCA1_pdt (462bp, PCA2_pdt) Digest PCA2_pdt (417+26+19, EcoRI/BamHI, PCA2_dig) Digest pBca9145-Bca1144 (2967+2958+9, EcoRI/BglII, Vector_dig) Ligate PCA2_dig and Vector_dig (2474, Bca1144-CCOMT1) CCOMT-1_oligo_12: ATATAGATGCCGTCCTAGCGAATTCATGAGATCTGCATCGTCTCATCGGTCTCCT CCOMT-1_oligo_1: TTATTTGTGTCTCACCTGTAGATCCCATAGGAGACCGATGAGACGATGCAGATCT CCOMT-1_oligo_9: ATGGGATCTACAGGTGAGACACAAATAACTCCTACACATATTTCTGATGAAGAAG CCOMT-1_oligo_3: GAGGCCAACTGCATTGCAAATAAGTTAGCTTCTTCATCAGAAATATGTGTAGGAG CCOMT-1_oligo_5: CTAACTTATTTGCAATGCAGTTGGCCTCTGCTTCAGTTTTGCCTATGATTTTGAA CCOMT-1_oligo_4: CTCTAATAAGTCCAATTCTAAAGCTGATTTCAAAATCATAGGCAAAACTGAAGCA CCOMT-1_oligo_11: ATCAGCTTTAGAATTGGACTTATTAGAGATTATTGCTAAGGCAGGTCCTGGAGC CCOMT-1_oligo_2: TGAGGCAATTTCGATAGGTGAAATTTGTGCTCCAGGACCTGCCTTAGCAATAAT CCOMT-1_oligo_14: ACAAATTTCACCTATCGAAATTGCCTCACAATTACCAACAACAAACCCTGATGC CCOMT-1_oligo_6: CCTTAACATCCTATCCAACATTACTGGGGCATCAGGGTTTGTTGTTGGTAATTG CCOMT-1_oligo_7: CCCAGTAATGTTGGATAGGATGTTAAGGTTATTAGCTTGCTATATTATATTGAC CCOMT-1_oligo_3: ACCGTCTTGTTGTGTTCTTACAGAGCATGTCAATATAATATAGCAAGCTAATAA CCOMT-1_oligo_10: ATGCTCTGTAAGAACACAACAAGACGGTAAGGTACAAAGATTGTATGGATTAGC CCOMT-1_oligo_8: ATTCTTAACTAAATATTTTGCTACTGTTGCTAATCCATACAATCTTTGTACCTT CCOMT-1_oligo_16: AACAGTAGCAAAATATTTAGTTAAGAATGAAGATGGTGTTTCTATGAGACGGCA CCOMT-1_oligo_15: AAGTATCTTTCCTGTGCCCAGGATCCATGCCGTCTCATAGAAACACCATCTTC -- PCA1_pdt: AGATCTGCATCGTCTCATCGGTCTCCTATGGGATCTACAGGTGAGACACAAATAACTCCTACACATATTTCTGATGAAGAAGCTAACTTATTTGCAATGCAGTTGGCCTCTGCTTCAGTTTTGCCTATGATTTTGAAATCAGCTTTAGAATTGGACTTATTAGAGATTATTGCTAAGGCAGGTCCTGGAGCACAAATTTCACCTATCGAAATTGCCTCACAATTACCAACAACAAACCCTGATGCCCCAGTAATGTTGGATAGGATGTTAAGGTTATTAGCTTGCTATATTATATTGACATGCTCTGTAAGAACACAACAAGACGGTAAGGTACAAAGATTGTATGGATTAGCAACAGTAGCAAAATATTTAGTTAAGAATGAAGATGGTGTTTCTATGAGACGGCA PCA2_pdt: ATATAGATGCCGTCCTAGCGAATTCATGAGATCTGCATCGTCTCATCGGTCTCCTATGGGATCTACAGGTGAGACACAAATAACTCCTACACATATTTCTGATGAAGAAGCTAACTTATTTGCAATGCAGTTGGCCTCTGCTTCAGTTTTGCCTATGATTTTGAAATCAGCTTTAGAATTGGACTTATTAGAGATTATTGCTAAGGCAGGTCCTGGAGCACAAATTTCACCTATCGAAATTGCCTCACAATTACCAACAACAAACCCTGATGCCCCAGTAATGTTGGATAGGATGTTAAGGTTATTAGCTTGCTATATTATATTGACATGCTCTGTAAGAACACAACAAGACGGTAAGGTACAAAGATTGTATGGATTAGCAACAGTAGCAAAATATTTAGTTAAGAATGAAGATGGTGTTTCTATGAGACGGCATGGATCCTGGGCACAGGAAAGATACTT Bca1144-CCOMT1: gAATTCATGAGATCTGCATCGTCTCATCGGTCTCCTATGGGATCTACAGGTGAGACACAAATAACTCCTACACATATTTCTGATGAAGAAGCTAACTTATTTGCAATGCAGTTGGCCTCTGCTTCAGTTTTGCCTATGATTTTGAAATCAGCTTTAGAATTGGACTTATTAGAGATTATTGCTAAGGCAGGTCCTGGAGCACAAATTTCACCTATCGAAATTGCCTCACAATTACCAACAACAAACCCTGATGCCCCAGTAATGTTGGATAGGATGTTAAGGTTATTAGCTTGCTATATTATATTGACATGCTCTGTAAGAACACAACAAGACGGTAAGGTACAAAGATTGTATGGATTAGCAACAGTAGCAAAATATTTAGTTAAGAATGAAGATGGTGTTTCTATGAGACGGCATGGATCCtaaCTCGAGctgcaggcttcctcgctcactgactcgctgcgctcggtcgttcggctgcggcgagcggtatcagctcactcaaaggcggtaatacggttatccacagaatcaggggataacgcaggaaagaacatgtgagcaaaaggccagcaaaaggccaggaaccgtaaaaaggccgcgttgctggcgtttttccacaggctccgcccccctgacgagcatcacaaaaatcgacgctcaagtcagaggtggcgaaacccgacaggactataaagataccaggcgtttccccctggaagctccctcgtgcgctctcctgttccgaccctgccgcttaccggatacctgtccgcctttctcccttcgggaagcgtggcgctttctcatagctcacgctgtaggtatctcagttcggtgtaggtcgttcgctccaagctgggctgtgtgcacgaaccccccgttcagcccgaccgctgcgccttatccggtaactatcgtcttgagtccaacccggtaagacacgacttatcgccactggcagcagccactggtaacaggattagcagagcgaggtatgtaggcggtgctacagagttcttgaagtggtggcctaactacggctacactagaaggacagtatttggtatctgcgctctgctgaagccagttaccttcggaaaaagagttggtagctcttgatccggcaaacaaaccaccgctggtagcggtggtttttttgtttgcaagcagcagattacgcgcagaaaaaaaggatctcaagaagatcctttgatcttttctacggggtctgacgctcagtggaacgaaaactcacgttaagggattttggtcatgagattatcaaaaaggatcttcacctagatccttttaaattaaaaatgaagttttaaatcaatctaaagtatatatgagtaaacttggtctgacagttaccaatgcttaatcagtgaggcacctatctcagcgatctgtctatttcgttcatccatagttgcctgactccccgtcgtgtagataactacgatacgggagggcttaccatctggccccagtgctgcaatgataccgcgagacccacgctcaccggctccagatttatcagcaataaaccagccagccggaagggccgagcgcagaagtggtcctgcaactttatccgcctccatccagtctattaattgttgccgggaagctagagtaagtagttcgccagttaatagtttgcgcaacgttgttgccattgctacaggcatcgtggtgtcacgctcgtcgtttggtatggcttcattcagctccggttcccaacgatcaaggcgagttacatgatcccccatgttgtgcaaaaaagcggttagctccttcggtcctccgatcgttgtcagaagtaagttggccgcagtgttatcactcatggttatggcagcactgcataattctcttactgtcatgccatccgtaagatgcttttctgtgactggtgagtactcaaccaagtcattctgagaatagtgtatgcggcgaccgagttgctcttgcccggcgtcaatacgggataataccgcgccacatagcagaactttaaaagtgctcatcattggaaaacgttcttcggggcgaaaactctcaaggatcttaccgctgttgagatccagttcgatgtaacccactcgtgcacccaactgatcttcagcatcttttactttcaccagcgtttctgggtgagcaaaaacaggaaggcaaaatgccgcaaaaaagggaataagggcgacacggaaatgttgaatactcatactcttcctttttcaatattattgaagcatttatcagggttattgtctcatgagcggatacatatttgaatgtatttagaaaaataaacaaataggggttccgcgcacatttccccgaaaagtgccacctgacgtctaagaaaccattattatcatgacattaacctataaaaataggcgtatcacgaggcagaatttcagataaaaaaaatccttagctttcgctaaggatgatttctg
Will perform PCA1 on 2013-03-08
2013 03 08: Did not have PCR plates - will perform PCA1 on CCOMT-1 on 2013-03-09
2013 03 09: Performed PCA1 on CCOMT-1
'''PCA Assembly''' -OK, so you've got a bunch of oligos, now what? First, use this recipe and program to do initial assembly of the oligos (do a separate one of these reactions for each chunk you're assembling): Recipe 38 uL ddH2O 5 ul 10x expand buffer 5 ul 2mM dNTPs 1 ul oligo mixture (100uM total, mixture of oligos after combination of 100uM stocks) 0.75 ul Expand polymerase- From here, sample was given to John Wright: Program (can run JCA/PCA1) 2 min initial denature at 94oC 30 sec denature at 94oC 30 sec anneal at 55oC [This should be the overlap temp of your oligos - vary as needed] 30 sec extension at 72oC repeat 2-4 30 times total
2013 03 12 Regular Zymo Cleanup on PCA1 -> PCA2
Regular Zymo Cleanup The following procedure removes the polymerase, dNTPs, buffer, and most of the oligonucleotides from a PCR reaction. It also will remove the buffer and restriction enzymes from a restriction digest reaction. 1) Add 180 uL of Zymo ADB buffer (brown bottle) to a 33uL or 50uL reaction. ''ADB kills proteins and allows DNA to stick to the column'' 2) Transfer into the Zymo column (small clear guys) -spin through (1 minute, max g), discard waste. ''DNA is now stuck to white filtered column'' 3) Add 200 uL of Zymo Wash Buffer (which is basically 70% ethanol) -spin through, discard waste. 4) Add 200 uL of Zymo Wash Buffer -spin through, discard waste. 5) spin for 90 seconds, full speed to dry. 6) elute with water into a fresh Eppendorf tube, use the same volume of water as the volume of the original reaction -Elute by spinning at max (14000g) for 1 minute -When spinning, face tube caps against direction of spin so cap doesn't break off.
Then perform PCA2:
'''Amplification''' Now, you need to do an amplification of the correct full-length chunks. Clean up the assembly reaction with a zymo column; don't bother running it on a gel - it'll be a smeary mess and won't really help you. Save the purified product in case this step fails! For the amplification reaction, do a normal phusion program with 1 ul of the cleaned up assembly reaction as template, and using the outermost oligos for the chunk. That is: '''Recipe''' 1 ul each outer oligo (10 uM) -Dilute F/R oligos 1:10 from 100uM; in this case, oligo CCOMT1-12/CCOMT1-15 1 ul purified pca product .5 ul phusion 10 ul 5x phusion buffer 5 ul 2mM dNTPs 32.5 ul H2O Samples given to John to run the Program. 1:10 Oligo12/Oligo15 dilutions in small PCR tubes. Also stored purified PCA1 product in 4o box. '''Program''' 2 min initial denature at 94oC 30 sec denature at 94oC 30 sec anneal at 60oC [This should be high, as your outer oligos now have a huge overlap with the correct product] 30 sec extension at 68oC repeat 2-4 30 times total
2013 03 14 Gel from ALL class samples: File:Http://openwetware.org/images/f/fc/2013 03 13-JCA-gel1.jpg This gel is of the PCA2 products for the various synthons. The first lane is the His-tag part's IPCR product (currently unnamed), then molecular weight standards, then the rest are your PCA2's (I couldn't read the labels). All but three look fine. Lanes 4 and 8 look recoverable with a second PCR. The lane 3's reaction needs to be started over from scratch. Lane 7 just needs a careful gel purification. My sample is one of the last 3 lanes (probably 3rd or 2nd to last
Zymo Cleanup on PCA2 product
1. Add 180 uL of Zymo ADB buffer (brown bottle) to a 33uL or 50uL reaction. 2. Transfer into the Zymo column (small clear guys) 3. spin through, discard waste. 4. Add 200 uL of Zymo Wash Buffer (which is basically 70% ethanol) 5. spin through, discard waste. 6. Add 200 uL of Zymo Wash Buffer 7. spin through, discard waste. 8. spin for 90 seconds, full speed to dry. 9. elute with water into a fresh Eppendorf tube, use the same volume of water as the volume of the original reaction
EcoRI/BamHI Digest on PCA2_zymd
1. 1uL of NEB Buffer 2 (ADD THIS FIRST) 2. 8uL of eluted PCR product 3. 0.5uL EcoRI 4. 0.5uL BamHI Incubate at 37 degrees on the thermocycler for 1hr Run an agarose gel, and melt with 600uL ADB buffer at 55 degrees. ****NOTE: If you are running short of time, this is an acceptable stopping point If the DNA is shorter than 300bp, add 250uL of isopropanol and mix prior to loading it on the column
Zymo Gel Purification
1. Add 2uL Loading Dye to 10uL sample 2. Load all of sample into well -Gel "R" lane 5 3. Run gel @ 180V (Maximum before temperature heats gel to melt) ~20 minutes 4. Cut band out and incubate in 300uL ADB buffer until gel melted 5. Place in Fridge
Stopped here, will finish next week.
Robert Chen 13:07, 19 March 2013 (EDT)
Zymo Cleanup after Gel Purification
1. transfer into the Zymo column inside a collection tube (small clear guys) 2. spin through, discard waste. 3. Add 200 uL of Zymo Wash Buffer (which is basically 70% ethanol) 4. spin through, discard waste. 5. Add 200 uL of Zymo Wash Buffer 6. spin through, discard waste. 7. spin for 90 seconds, full speed to dry. 8. elute with water into a fresh Eppendorf tube. Water amount should be same as DNA input - '''8uL'''
Robert Chen 14:10, 21 March 2013 (EDT)
Ligation -> Heat Shock -> Plating
Ligation of EcoRI/BamHI digests
6.5uL ddH2O 1uL T4 DNA Ligase Buffer (small red or black-striped tubes) 1uL Vector digest 1uL Insert digest 0.5uL T4 DNA Ligase Pound upside down on the bench to mix Give it a quick spin to send it back to the bottom of the tube Incubate on the benchtop for 30min Put on ice and proceed to the transformation
Transformation Take competent cells to which TSS has been added. Heat shock Rescue with 2YT
Thaw a 200 uL aliquot of cells on ice Add 50 uL of water to the cells (if greater volume is desired) Add 30 uL of KCM to the cells Put your ligation mixture on ice, let cool a minute or two (for Miniprep product, dilute by 10, then use 1uL of dilution) Add 70 uL of the cell cocktail to the ligation, stir to mix Let sit on ice for 10 min Heat shock for 90 seconds at 42 (longer incubation may work better) Put back on ice for 1 min Add 100uL of 2YT, let shake in the 37 degree incubator for 1 hour (DID NOT RESCUE FOR 1 HOUR BECAUSE AMPICILLIN) Plate 70+ uL on selective antibiotics, let incubate at 37 degrees overnight
Robert Chen 13:41, 2 April 2013 (EDT)
Plates had 0 colonies on mine. Others had some success. 2/3 of BglII's worked, 1 didn't, suggesting Enzyme is expired? We will redo digest on PCA2 cleaned, and also run a gel on our digested product to make sure we have DNA.
EcoRI/BamHI Digest on PCA2_zymd - Exp 2
1. 1uL of NEB Buffer 2 (ADD THIS FIRST) 2. 8uL of eluted PCR product 3. 0.5uL EcoRI 4. 0.5uL BamHI Incubate at 37 degrees on the thermocycler for 1hr Run an agarose gel, and melt with 600uL ADB buffer at 55 degrees. ****NOTE: If you are running short of time, this is an acceptable stopping point If the DNA is shorter than 300bp, add 250uL of isopropanol and mix prior to loading it on the column
Robert Chen 14:04, 4 April 2013 (EDT)
Remember - this is the second attempt. Our gels showed that our last digest product had DNA, so DNA WAS PRESENT!!
Notice that we didn't add H2O in this procedure to the bacteria!
Ligation EcoRI/BamHI
6.5uL ddH2O 1uL Ligation Buffer 1uL vector 1uL insert 0.5 uL Enzyme (ADD THIS LAST) Incubate 30 minutes on bench after mixing, then put on ice and proceed to transformation
Transformation by Heat Shock
1. Thaw a 200 uL aliquot of cells on ice 2. Add 50 uL of water to the cells (if greater volume is desired) 3. Add 30 uL of KCM to the cells 4. Put your ligation mixture on ice, let cool a minute or two (for Miniprep product, dilute by 10, then use 1uL of dilution) 5. Add 70 uL of the cell cocktail to the ligation, stir to mix 6. Let sit on ice for 10 min 7. Heat shock for 90 seconds at 42 (longer incubation may work better) 8. Put back on ice for 1 min 9. Add 100uL of 2YT, let shake in the 37 degree incubator for 1 hour (DIDN'T DO THIS) 10. Plate 70+ uL on selective antibiotics, let incubate at 37 degrees overnight
Robert Chen 14:06, 9 April 2013 (EDT)
We picked colonies without performing colony PCR:
Picking of colonies
For each construct you will pick and later miniprep 2 colonies Add 4mL of LB media with the appropriate antibiotics to a clean test tube Pick a well-isolated, round, and "normal" looking colony with a toothpick Drop it in the test tube Incubate at 37 overnight
Robert Chen 14:00, 11 April 2013 (EDT)
RESULTS: Cultures grew! We now want to: Miniprep cultures, restriction map with ECORI/XhoI, Run on a gel, submit to sequencing
Miniprep Cultures:
1. Miniprep cultures
Miniprep purification of DNA MINIPREP (2mL) Procedure for Plasmid DNA Purification (using the QIAGEN QIAPrep Spin Miniprep kit) !!!!! Make sure Ethanol has been added to the PE Buffer !!!!! !!!!! Make sure that RNAse has been added to the P1 Buffer !!!!! Pellet 2 mL saturated culture by spinning full speed, 30 seconds in a 2mL Microcentrifuge tube. Dump supernatant Add 250uL of P1 buffer into each tube. Resuspend the cells thoroughly Add 250uL of P2 buffer (a base that denatures everything and causes cells to lyse). Gently mix up and down. Solution should become clearer. Add 350uL of N3 buffer (an acid of pH ~5 that causes cell junk - including protein and chromosomal DNA - to precipitate, and leaves plasmids and other small molecules in solution). Slowly invert a few times, then shake. Spin in centrifuge at top speed for 5 minutes. Label blue columns with an alcohol-resistant lab pen. Pour liquid into columns, and place the columns into the centrifuge. Spin at full speed for 15 seconds. Dump liquid out of the collectors under the columns (the DNA should be stuck to the white resin) Wash each column with 500 uL of PB buffer. Spin in centrifuge at full speed for 15 seconds, then flick out the liquid again. Wash with 750uL of PE buffer (washes the salts off the resins). Spin in centrifuge at full speed for 15 seconds and flick out liquid again. Spin in centrifuge at full speed for 90 sec to dry off all water and ethanol. Label new Microcentrifuge tubes and put columns in them. Elute them by adding 50uL of water down the middle of the column (don't let it stick to the sides). Spin in centrifuge at top speed for 30 seconds. Take out columns and cap the tubes. Clean up - note the P1 buffer is stored at 4degC and all the rest at room temperature.
Test Digest with EcoRI and XhoI
7 uL ddH2O 1uL Miniprepped plasmid 1uL 10x NEB Buffer 2 0.5uL EcoRI 0.5uL BamHI Incubate at 37 on the thermocycler for 30 minutes Run an analytical gel
Take a picture of the gel Calculate the expected fragment sizes Are the calculated sizes consistent with the bands on the gel? Other notes about Test Digest
In this protocol, you are trying to 'map' your plasmid to determine whether it is likely to be the desired sequence. There are two pieces of information you need to consider before setting up the digest: How much DNA should I use? What restriction enzymes should I use? The choice of how much of your miniprepped plasmid to add depends on the concentration of DNA in the sample, which primarily reflects the copy number of the plasmid in the cell, which is primarily determined by what origin of replication is on the plasmid. However, subtleties about how you do the miniprep procedure, what else is on the plasmid, and any stress/load present in the bacterium can affect the plasmid yield. To a first approximation, you can make this decision based on the origin of replication: colE1 (pUC plasmids, such as pBca9145, pBca9523, pBca9525 vectors) : use 1uL as it is very high copy colE1+ROP (pBR322-derived plasmids that retain ROP) : use 2uL as it's a little lower when ROP is present p15A (such as pBgl0001 and pAC vectors) : use 4uL as it is medium copy pSC101 : use 6 uL as it's lower copy F plasmid (such as BACs) : use 8uL since these are very low copy Just use that volume of DNA, and adjust the amount of water so that things add up to 10uL The choice of what restriction enzymes to use involves using ApE (or an equivalent tool that predicts the fragmentation pattern of a restriction digest). Your primary goal is to distinguish your product from the plasmid that you inserted your part into. Often that means, say, distinguishing pBca9145-Bca1144#5 from your product pBca9145-sbb1222. The reason for this is that primarily what bleeds through onto the plate is this parent plasmid, or mutants thereof. So, you want to find one or two enzymes that gives a clearly-different restriction pattern in your product from that of the parent vector. Scenarios: A good place to start is considering using combinations of the BioBrick format enzymes (for BglBricks, that means EcoRI, BamHI, BglII, XhoI) or the enzymes you used during your cloning. If the part that you inserted is significantly larger or smaller than the one in the parent vector, this is a very good strategy as you'll get 2 bands for both parent and product, and you can tell by the size which is which. Sometimes your part is too similar in size to the parent part. Under these circumstances, look for a restriction site that is in the product part but absent in the parent part. Use that enzyme in combination with one of the BioBrick enzymes. Sometimes your part is too short to see well on the gel, even though it is readily distinguishable from the parent part. Here, you should consider using other enzymes in the backbone of both plasmids in conjunction with a BioBrick enzyme to get a unique pattern. AlwNI is often useful in this regard. 'fingerprinting' the plasmids with DpnI often will disambiguate hard-to-distinguish cases. Here, you use an enzyme that cuts many times in the plasmids, and the fragmentation pattern will often give a different spectrum in the parent and product.
Sent ? and ? for sequencing
Robert Chen 13:18, 16 April 2013 (EDT)
Sequencing worked!
Check sequencing against PCA2 product from beginning, CONFIRMED! Chose CCOMT1A (Sequencing A5). We can't continue because CCOMT2 doesn't have a sequence we can use.
Finished for the day.
Robert Chen 14:04, 18 April 2013 (EDT)
Helping out with CCOMT2 so that we can get our project up to speed!
1. Mini-prep CCOMT2 2. Restriction Map with BsmBI (Eco/Xho were missing):
6.5uL H2O 2uL DNA 1uL NEB Buffer 3 0.5uL BsmBI Thermo for 30 minutes - 1 hour Load gel (all into 6x diluted Dye
3. Send to sequencing!
Robert Chen 16:47, 19 April 2013 (EDT)
Golden Gate Reaction on CCOMT1,2,3
6.5uL ddH2O 1uL Ligase Buffer 0.5uL Ligase 0.5uL BsmB1 1uL of Synthon Mix (mix all three synthons, then take 1 uL) 0.5uL Vector
Robert Chen 13:12, 23 April 2013 (EDT)
To do: Transform Cells with Golden Gate Product, Rescue (Chlorinphenicol is a translation inhibitor, so we need a rescue step to allow cells to start producing the antibiotic resistance), and Plate
Heat Shock Transformation, Rescue, and Plating
1. Thaw a 200 uL aliquot of cells on ice 2. Add 50 uL of water to the cells (if greater volume is desired) 3. Add '''20 uL''' of KCM to the cells 4. Put your ligation mixture on ice, let cool a minute or two (for Miniprep product, dilute by 10, then use 1uL of dilution) 5. Add 70 uL of the cell cocktail to the ligation, stir to mix 6. Let sit on ice for 10 min 7. Heat shock for 90 seconds at 42 (longer incubation may work better) 8. Put back on ice for 1 min 9. Add 100uL of 2YT, let shake in the 37 degree incubator for 1 hour 10. Plate 70+ uL on selective antibiotics, let incubate at 37 degrees overnight
Robert Chen 14:06, 25 April 2013 (EDT)
CCOMT worked!! Chris picked our colonies, and we want to: 1) Miniprep 2) Restriction map with BsaI
Mini-Prep
Pellet 2 mL saturated culture by spinning full speed, 30 seconds in a 2mL Microcentrifuge tube. Dump supernatant Add 250uL of P1 buffer into each tube. Resuspend the cells thoroughly Add 250uL of P2 buffer (a base that denatures everything and causes cells to lyse). Gently mix up and down. Solution should become clearer. Add 350uL of N3 buffer (an acid of pH ~5 that causes cell junk - including protein and chromosomal DNA - to precipitate, and leaves plasmids and other small molecules in solution). Slowly invert a few times, then shake. Spin in centrifuge at top speed for 5 minutes. Label blue columns with an alcohol-resistant lab pen. Pour liquid into columns, and place the columns into the centrifuge. Spin at full speed for 15 seconds. Dump liquid out of the collectors under the columns (the DNA should be stuck to the white resin) Wash each column with 500 uL of PB buffer. Spin in centrifuge at full speed for 15 seconds, then flick out the liquid again. Wash with 750uL of PE buffer (washes the salts off the resins). Spin in centrifuge at full speed for 15 seconds and flick out liquid again. Spin in centrifuge at full speed for 90 sec to dry off all water and ethanol. Label new Microcentrifuge tubes and put columns in them. Elute them by adding 50uL of water down the middle of the column (don't let it stick to the sides). Spin in centrifuge at top speed for 30 seconds. Take out columns and cap the tubes. Clean up - note the P1 buffer is stored at 4degC and all the rest at room temperature.
BsaI digest
6.5uL H2O 2uL Plasmid DNA 1uL NEB4 0.5uL BsaI Thermocycle for 30 minutes