SBB13Ntbk-Tai Lun Ng: Difference between revisions
Tai Lun Ng (talk | contribs) |
Tai Lun Ng (talk | contribs) |
||
| Line 1: | Line 1: | ||
== April 23, 2013 == | == April 23, 2013 == | ||
Today " | |||
Transformation by Heat-Shock | |||
1. Thaw a 200 uL aliquot of cells on ice. | |||
2. Add 20 uL of KCM to the cells. | |||
3. Put your ligation mixture on ice, let cool a minute or two. | |||
4. Add 70 uL of the cell cocktail to the ligation, stir to mix | |||
5. Let sit on ice for 10 min. | |||
6. Heat shock for 90 seconds at 42°C. | |||
7. Put back on ice for 1 min. | |||
8. Add 100uL of 2YT, let shake in the 37°C incubator for 1 hour. | |||
9. Plate 70+ uL on selective antibiotics, let incubate at 37°C overnight. | |||
== April 19, 2013 == | == April 19, 2013 == | ||
Revision as of 18:48, 11 May 2013
April 23, 2013
Today " Transformation by Heat-Shock 1. Thaw a 200 uL aliquot of cells on ice. 2. Add 20 uL of KCM to the cells. 3. Put your ligation mixture on ice, let cool a minute or two. 4. Add 70 uL of the cell cocktail to the ligation, stir to mix 5. Let sit on ice for 10 min. 6. Heat shock for 90 seconds at 42°C. 7. Put back on ice for 1 min. 8. Add 100uL of 2YT, let shake in the 37°C incubator for 1 hour. 9. Plate 70+ uL on selective antibiotics, let incubate at 37°C overnight.
April 19, 2013
RESULTS: "None of the Golden Gate reactions wroked as we did not have colonies. "
'Goal for Today: Redo Golden Gate Assembly with new protocol
4.5uL ddH2O
1uL Ligase buffer
0.5uL Ligase
0.5uL BsmB1
1uL TOTAL construct mix
0.5uL Vector
April 18, 2013
Goal for Today: Transform the assembled product into cells
1. The plasmids with the tentative Faccomt gene are heatshocked into competent cells
2. The protocol is as follow
1. Thaw a 200 uL aliquot of cells on ice.
2. Add 20 uL of KCM to the cells.
3. Put your ligation mixture on ice, let cool a minute or two.
4. Add 70 uL of the cell cocktail to the ligation, stir to mix
5. Let sit on ice for 10 min.
6. Heat shock for 90 seconds at 42°C.
7. Put back on ice for 1 min.
8. Add 100uL of 2YT, let shake in the 37°C incubator for 1 hour.
9. Plate 70+ uL on selective antibiotics, let incubate at 37°C overnight.
3. GSI will grow the culture on the plate
April 16, 2013
Goal for Today: Check Sequencing. If correct: Golden Gate all the synthons together
1. Compare predicted PCR product with the sequence files
2. FaCCOMT2A and FaCComt 3A sequences look correct.
3. See Young have correct synthon part for FaCCOMT 1A
4,. Set up the Golden Gate Reaction.
4.5uL ddH2O
1uL Ligase buffer
0.5uL Ligase
0.5uL BsmB1
1uL per construct
0.5uL Vector
5. GSI will continue the 4 hour ligation for us.
April 11, 2013
RESULTS: cultures grew
Goal for Today:Miniprep cultures, restriction map with ECORI/XhoI, Run on a gel, submit to sequencing
1. Miniprep cultures http://openwetware.org/wiki/Template:SBB-Protocols_Micro3
2. Test Digest with ECORI and XhoI http://openwetware.org/wiki/Template:SBB-Protocols_Enz6
3. Run the gel
4. All the synthon candidate parts looked correct: submitted them for sequencing!
April 9, 2013
RESULTS: There are colonies this time!
Goal for Today:Pick colonies and start cultures
1. Used pipette tip to pick colonies from the plates
2. Dipped it into media with selection antibiotic
3. GSI and instructor grew them for us
April 4, 2013
Goal for Today: Ligate pcrpdt digest with vector digest, transform into MC1061 cells via heat shock, plate the cells
1. Instructor performed PCA and digested the pcrdpt with ECORI and BAMHI
2. Perform a ligation reaction (http://openwetware.org/wiki/Template:SBB-Protocols_Enz4)
3. Transform into MC1061 cells (http://openwetware.org/wiki/Template:SBB-Protocols_Micro1)
NOTE: no ddH2O. Just 1 tube cells with 30uL KCM
4. Plate the cells on ampicillin plates
April 2, 2013
RESULT from March 21, 2013: Very little colonies on plate. Systematic Error in class?
Goal for Today:Run digested PCRpdt on the gel to see if we have any DNA material
1. Mixed 0.5uL of 6x loading dye with 2 uL of pcrdigest
2. Ran the gel
3. Result: There is an apparent band. Can proceed to transformation on Thursday
March 21, 2013
Goal for Today: Ligate pcrpdt digest with vector digest, transform into MC1061 cells via heat shock, plate the cells
1. Instructor performed PCA and digested the pcrdpt with ECORI and BAMHI
2. Perform a ligation reaction (http://openwetware.org/wiki/Template:SBB-Protocols_Enz4)
3. Transform into MC1061 cells (http://openwetware.org/wiki/Template:SBB-Protocols_Micro1)
4. Plate the cells on ampicillin plates
March 19, 2013
Goal for TODAY: Zymo cleanup PCA2 pcrpdt from March 15, 2013 and test digest with ECORI and BAMHI
1. Pick up PCA pcrpdt of FCCOMT-2
2. Test digest pcrpdt with ECORI and BAMHI http://openwetware.org/wiki/Template:SBB-Protocols_Enz2
3. loaded the digpdt in 1% agarose gel
4. Run the gel at 170V for 20 minutes.
RESULT: no band appeared
March 14, 2013
RESULT from March 12, 2013: PCR band for FCCOMT-2 did not appear strongly (lane 8).
![]()
Goal for Today: Load the minute pcrpdt, gel purify it out, reamplify with external oligo
1. Added 10 uL of PCR product and 2uL of dye into 1% agarose gel
2. Run on gel at 120V for 20 minutes
3. A band appeared. Gel cut out
5. Zymo gel purify with the kit. (http://openwetware.org/wiki/Template:SBB-Protocols_Zymo3)
6. Run PCA2 with FaCCOMT-2_oligo_12 to FaCCOMT-2_oligo_14 (http://openwetware.org/wiki/Template:SBB-PCA)
7. GSI ran the thermocycler
March 12, 2013
Goal for Today: Set up PCA 2 reaction
1. Pick up the pcrpdt
2. Run the PCA2 reaction with external olgios FCCOMT-12 and FCCOMT-14 http://openwetware.org/wiki/Template:SBB-PCA
3. GSI ran the thermocycler.
March 8, 2013
Goal for Today: Set up PCA1 reaction
1. Followed the protocol for PCA1 reaction. (http://openwetware.org/wiki/Template:SBB-PCA)
2. GSI ran the thermocycler
March 5, 2013
Construction File for PCA assembly of FaCCOMT-2
1. Make a 100uM 1 ul oligo mixture of FaCCOMT-2_oligo_1 to FaCCOMT-2_oligo_16
2. PCA FaCCOMT-2_oligo_1 to FaCCOMT-2_oligo_16 {pca1, 465 bp}
3. Zymo cleanup
4. PCA2 pca1 with FaCCOMT-2_oligo_12 to FaCCOMT-2_oligo_14 {pcrpdt, 465 bp}
5. Zymo cleanup the amplification reactions
6. Digest the product with EcoRI/BAMHI {pcrdig,420bp + 20 + 25, L}
7. Digest PBCA1945 with ECORI/BAMHI {vectdig,696+2057 bp, L}
8. Ligate pcrdig + vectdig {Pca9145-FaCCOMT-2, 2477 bp}
pcrpdt
ATATAGATGCCGTCCTAGCGAATTCATGAGATCTGCATCGTCTCAGATGGTGTTTCTATCGCAGCATTGTGCTTAATGAACCAAGATAAGGTCTTAGTCGAGTCATGGTATCATTTGAAAGATGCTGTTTTGGACGGTGGTATTCCTTTTAATAAGGCATACGGAATGACAGCCTTCGATTACCATGGTACTGATCCAAGATTTAATAAAGTTTTCAACAAAGGAATGGCTGACCACTCTACTATTACAATGAAGAAAATCTTGGAAACTTACAAGGGTTTCGAGGGTTTAAAATCAATAGTAGACGTAGGTGGTGGAACTGGTGCTGTTGTTAATATGATTGTATCTAAATATCCTTCAATTAAGGGTATAAATTTCGACTTACCTCATGTAATTGAGGATGCTCCACAATACCCAGGTGTCCAGCATGAGACGGCATGGATCCTGGGCACAGGAAAGATACTT (465bp)
Pca9145-FaCCOMT-2 gAATTCATGAGATCTGCATCGTCTCAGATGGTGTTTCTATCGCAGCATTGTGCTTAATGAACCAAGATAAGGTCTTAGTCGAGTCATGGTATCATTTGAAAGATGCTGTTTTGGACGGTGGTATTCCTTTTAATAAGGCATACGGAATGACAGCCTTCGATTACCATGGTACTGATCCAAGATTTAATAAAGTTTTCAACAAAGGAATGGCTGACCACTCTACTATTACAATGAAGAAAATCTTGGAAACTTACAAGGGTTTCGAGGGTTTAAAATCAATAGTAGACGTAGGTGGTGGAACTGGTGCTGTTGTTAATATGATTGTATCTAAATATCCTTCAATTAAGGGTATAAATTTCGACTTACCTCATGTAATTGAGGATGCTCCACAATACCCAGGTGTCCAGCATGAGACGGCATGGATCCtaaCTCGAGctgcaggcttcctcgctcactgactcgctgcgctcggtcgttcggctgcggcgagcggtatcagctcactcaaaggcggtaatacggttatccacagaatcaggggataacgcaggaaagaacatgtgagcaaaaggccagcaaaaggccaggaaccgtaaaaaggccgcgttgctggcgtttttccataggctccgcccccctgacgagcatcacaaaaatcgacgctcaagtcagaggtggcgaaacccgacaggactataaagataccaggcgtttccccctggaagctccctcgtgcgctctcctgttccgaccctgccgcttaccggatacctgtccgcctttctcccttcgggaagcgtggcgctttctcatagctcacgctgtaggtatctcagttcggtgtaggtcgttcgctccaagctgggctgtgtgcacgaaccccccgttcagcccgaccgctgcgccttatccggtaactatcgtcttgagtccaacccggtaagacacgacttatcgccactggcagcagccactggtaacaggattagcagagcgaggtatgtaggcggtgctacagagttcttgaagtggtggcctaactacggctacactagaaggacagtatttggtatctgcgctctgctgaagccagttaccttcggaaaaagagttggtagctcttgatccggcaaacaaaccaccgctggtagcggtggtttttttgtttgcaagcagcagattacgcgcagaaaaaaaggatctcaagaagatcctttgatcttttctacggggtctgacgctcagtggaacgaaaactcacgttaagggattttggtcatgagattatcaaaaaggatcttcacctagatccttttaaattaaaaatgaagttttaaatcaatctaaagtatatatgagtaaacttggtctgacagttaccaatgcttaatcagtgaggcacctatctcagcgatctgtctatttcgttcatccatagttgcctgactccccgtcgtgtagataactacgatacgggagggcttaccatctggccccagtgctgcaatgataccgcgagacccacgctcaccggctccagatttatcagcaataaaccagccagccggaagggccgagcgcagaagtggtcctgcaactttatccgcctccatccagtctattaattgttgccgggaagctagagtaagtagttcgccagttaatagtttgcgcaacgttgttgccattgctacaggcatcgtggtgtcacgctcgtcgtttggtatggcttcattcagctccggttcccaacgatcaaggcgagttacatgatcccccatgttgtgcaaaaaagcggttagctccttcggtcctccgatcgttgtcagaagtaagttggccgcagtgttatcactcatggttatggcagcactgcataattctcttactgtcatgccatccgtaagatgcttttctgtgactggtgagtactcaaccaagtcattctgagaatagtgtatgcggcgaccgagttgctcttgcccggcgtcaatacgggataataccgcgccacatagcagaactttaaaagtgctcatcattggaaaacgttcttcggggcgaaaactctcaaggatcttaccgctgttgagatccagttcgatgtaacccactcgtgcacccaactgatcttcagcatcttttactttcaccagcgtttctgggtgagcaaaaacaggaaggcaaaatgccgcaaaaaagggaataagggcgacacggaaatgttgaatactcatactcttcctttttcaatattattgaagcatttatcagggttattgtctcatgagcggatacatatttgaatgtatttagaaaaataaacaaataggggttccgcgcacatttccccgaaaagtgccacctgacgtctaagaaaccattattatcatgacattaacctataaaaataggcgtatcacgaggcagaatttcagataaaaaaaatccttagctttcgctaaggatgatttctg