BME103:W930 Group7 l2
| Home People Lab Write-Up 1 Lab Write-Up 2 Lab Write-Up 3 Course Logistics For Instructors Photos Wiki Editing Help | |||||||||||||||||||||||||||||||||||
OUR TEAMLAB 2 WRITE-UPThermal Cycler EngineeringOur re-design is based upon the Open PCR system originally designed by Josh Perfetto and Tito Jankowski. System Design While the system proved to be useful in previous experiments, many setbacks occurred due to the physical restraints of the device. The overall design had many advantages (i.e. low cost, portable, simple assembly) but small parts of the system needed adjustments in order to operate on an acceptable level. Troubles we encountered included a long wait time for the system to cool to the necessary temperatures, difficulty opening the latch for the lid, and the restrictive sample size.
Key Features The key features involved with the newly designed PCR machine can be easily renovated at a low cost to immensely improve the quality. A few extra holes drilled into the housing block can reduce the number of trials by maximizing the amount of DNA samples in each trial with a few simple incisions. Simple slots can be cut through the wooden walls for added ventilation to prevent over heating. And finally, the old lid was a hassle. There are many other ways to secure the vials in the housing block all while providing easy access to open when needed.
ProtocolsMaterials
Research and Development![]() ![]() Background on Disease Markers The two diseases we decided to analyze are Alzheimer's and Anencephaly. Alzheimer's disease is a form of dementia that affects the brain by gradually deteriorating an individual's brain function, leading to memory loss and impairing cognitive skills. The gene responsible for Alzheimer's is labeled PSEN1 and a mutation in this gene can cause toxic protein to build up in the brain leading to symptoms described above. The gene is found on chromosome 14 and the SNP reference number for this gene is rs63751320. The sequence for SNP is GCTCATCTTGGCTGTGATTTCAGTAT[A/C]TGGTAAAACCCAAGACTGATAATTT. For more information on this gene can be found on this link. [1]
The SNP associated with Meckel syndrome is rs121918202, the gene sequence for this SNP is ATGTAATTTTATTTTCATTTTAGCTG[C/T]AGGATAGAATTAATGATTTAGAAAA
Alzheimer- Alleles: [A/C] Forward Primer:5'CGTGGCTCATCTTGGCTGTGATTT3' Reverse Primer:3'CCCGACACTAACCTCGTCTAACAT5' The disease allele, in this case C, will give a PCR product because the PCR detects the specific allele difference or mutation and gives a positive reading. Since the PCR detects the specific allele mutation, a non-disease allele will not produce a product. Anencephaly : Alleles: [C/T] Forward Primer: TAATATGTAATTTTATTTTCATTTTAGCTG Reverse Primer: GTTAATTTTCTAAATCATTAATTCTATCCT The disease allele, in this case T, will give a PCR product because the PCR detects the specific allele difference or mutation and gives a positive reading. Since the PCR detects the specific allele mutation, a non-disease allele will not produce a product.
Bayes Analysis of Anencephaly P(A│B)= (P(B│A)P(A))/P(B) Where P(A|B) is the probability that Meckel syndrome will occur given a positive PCR test result (a T present instead of a C in the SNP), P(B|A) is the probability that a Meckel fetus will test positive for the disease, P(A) is the probability of having the Meckel syndrome mutation, and P(B) is the probability of people without the Meckel mutation that yield positive results.
| |||||||||||||||||||||||||||||||||||








