Cfrench:primerlist

From OpenWetWare
Revision as of 11:09, 21 August 2007 by Cfrench (talk | contribs)
Jump to navigationJump to search

Catalog of primers

Primers for iGEM2007 flavours/fragrances project

echf1 aat gaattc gcggccgc t tctag atg agc aaa tac gaa ggt c

  • Purpose: forward primer for ech (ferA) coding sequence from Ps. fluorescens NCIMB 9046.
  • Restriction sites: EcoRI, XbaI
  • Notes: no ribosome binding site included.

echr1 ct actagt a tta tta gcg ttt ata ggc ttg cag c

  • Purpose: reverse primer for ech (ferA) coding sequence from Ps. fluorescens NCIMB 9046.
  • Restriction sites: SpeI only.
  • Notes: replaces TGA stop codon with TAA TAA. Also replaces PstI site in coding sequence with silent mutation.

fcsf1 aat gaattc gcggccgc t tctag atg cgc tcc ctg gaa ccc

  • Purpose: forward primer for fcs (ferB) coding sequence from Ps. fluorescens NCIMB 9046.
  • Restriction sites: EcoRI, XbaI
  • Notes: no ribosome binding site included.

fcsr1 ct actagt a tta tta cgg ttt ggg ccc ggc ac

  • Purpose: reverse primer for fcs (ferB) coding sequence from Ps. fluorescens NCIMB 9046.
  • Restriction sites: SpeI only.
  • Notes: replaces TGA stop codon with TAA TAA.

Ms_COMTf1 aat gaattc gcggccgc t tctag atg ggt tca aca ggt gaa ac

  • Purpose: forward primer for caffeate O-methltransferase coding sequence from Medicago sativa (alfalfa).
  • Restriction sites: EcoRI, XbaI.
  • Notes: eukaryotic gene, no ribosome binding site.

Ms_COMTr1 ct actagt a tta tta aac ctt ctt aag aaa ctc c

  • Purpose: reverse primer for caffeate O-methltransferase coding sequence from Medicago sativa (alfalfa).
  • Restriction sites: SpeI only (NOT PstI).
  • Notes: adds TAA TAA stop codons.

echf2 atc gagctc acacc cagaa caaga gc

  • Date: 9 August 2007.
  • Purpose: amplify ech from Pseudomonas with rbs and some surrounding DNA.
  • Restriction sites: SacI
  • Notes: this was made because no product was obtained with echf1 and echr1.

echr2 tt actagt atcgg gaaca cgttc aagc

  • Date: 9 August 2007.
  • Purpose: amplify ech from Pseudomonas with rbs and some surrounding DNA.
  • Restriction sites: SpeI
  • Notes: this was made because no product was obtained with echf1 and echr1.

fcsf2 gtg gagctc actga agaac agggc gtg

  • Date: 9 August 2007.
  • Purpose: amplify fcs from Pseudomonas with rbs and some surrounding DNA.
  • Restriction sites: SacI
  • Notes: this was made because no product was obtained with fcsf1 and fcsr1.

fcsr2 aa actagt atgcc gtgac agcaa atagg

  • Date: 9 August 2007.
  • Purpose: amplify fcs from Pseudomonas with rbs and some surrounding DNA.
  • Restriction sites: SpeI
  • Notes: this was made because no product was obtained with fcsf1 and fcsr1.

sam5f1 at gaattc gcggccgc t tctag atg acc atc acg tca cct g

  • Date: 9 August 2007.
  • Purpose: amplify sam5 from Saccharothrix espanaensis.
  • Restriction sites: EcoRI, NotI, XbaI (not SacI!)
  • Notes: coding sequence only, no ribosome binding site.

sam5r1 ct actagt a tta tta ggt gcc ggg gtt gat cag

  • Date: 9 August 2007.
  • Purpose: amplify sam5 from Saccharothrix espanaensis.
  • Restriction sites: SpeI (not PstI!)
  • Notes: coding sequence modified to end with TAA TAA.

sam8f1 at gaattc gcggccgc t tctag atg acg cag gtc gtg gaa cg

  • Date: 9 August 2007.
  • Purpose: amplify sam8 from Saccharothrix espanaensis.
  • Restriction sites: EcoRI, NotI, XbaI (not SacI!)
  • Notes: coding sequence only, no ribosome binding site.

sam8r1 ct actagt a tta tta tcc gaa atc ctt ccc gtc

  • Date: 9 August 2007.
  • Purpose: amplify sa85 from Saccharothrix espanaensis.
  • Restriction sites: SpeI (not PstI!)
  • Notes: coding sequence modified to end with TAA TAA.

crtEf1 gca gagctc gcgt tgcc gtaa atgt atc

  • Date: 13 August 2007
  • Purpose: amplification of crtE from Pantoea ananatis ATCC 19321 (DSM 30080)
  • Restriction sites: SacI
  • Notes: amplification from cell suspension was successful.

crtEr1 aa actagt gcga tcgc cgcg aaat g

  • Date: 13 August 2007
  • Purpose: amplification of crtE from Pantoea ananatis ATCC 19321 (DSM 30080)
  • Restriction sites: SpeI
  • Notes: amplification from cell suspension was successful. Product size 997 bp.

crtYf1 cag gagctc ttaa gtgg gagc ggct atg

  • Date: 13 August 2007
  • Purpose: amplification of crtY from Pantoea ananatis ATCC 19321 (DSM 30080)
  • Restriction sites: SacI
  • Notes: amplification from cell suspension was successful.

crtYr1 ac actagt tggt ttca tgta gtcg

  • Date: 13 August 2007
  • Purpose: amplification of crtY from Pantoea ananatis ATCC 19321 (DSM 30080)
  • Restriction sites: SpeI
  • Notes: amplification from cell suspension was successful. Product size 1202 bp.

crtIf1 tga gagctc atcg ttaa agag cgac

  • Date: 13 August 2007
  • Purpose: amplification of crtIB from Pantoea ananatis ATCC 19321 (DSM 30080)
  • Restriction sites: SacI
  • Notes: amplification from cell suspension was successful. Note that crtI contains two PstI sites.

crtBr1 gc actagt caaa actt cagg cgac

  • Date: 13 August 2007
  • Purpose: amplification of crtIB from Pantoea ananatis ATCC 19321 (DSM 30080)
  • Restriction sites: SpeI
  • Notes: amplification from cell suspension was successful. Note that crtI contains two PstI sites. Product size 2477 bp.

crtZf1 aga gagctc tacc ggag aaat tatg

  • Date: 13 August 2007
  • Purpose: amplification of crtZ from Pantoea ananatis ATCC 19321 (DSM 30080)
  • Restriction sites: SacI
  • Notes: amplification from cell suspension was successful. Note that crtZ is encoded on the opposite strand to crtEXYBI.

crtZr1 cc actagt cagg ccct tact tccc

  • Date: 13 August 2007
  • Purpose: amplification of crtZ from Pantoea ananatis ATCC 19321 (DSM 30080)
  • Restriction sites: SpeI
  • Notes: amplification from cell suspension was successful. Note that crtZ is encoded on the opposite strand to crtEXYBI. Product size 565 bp.

crtopr1 cc actagt ggag tact tccc gatg

  • Date: 13 August 2007
  • Purpose: amplification of crt region (with primer crtEf1) from Pantoea ananatis ATCC 19321 (DSM 30080)
  • Restriction sites: SpeI
  • Notes: amplification from cell suspension was successful. Note that crtZ is encoded on the opposite strand to crtEXYBI, so reverse primer crtZr1 could not be used to amplify the whole region. (crtZf1 would have given a product but with SacI sites at both ends.) Product size 6490 bp.


Primers for iGEM2007 bioswitches project

revPlacf1 tcta gagctc tgtgtgaaattgttatccg

  • Purpose: forward biobrick primer for making a reverse lac promoter.
  • Restriction sites: XbaI (probably won't cut as right at end), SacI

revPlacr1 ct actagt a caatacgcaaaccgcctc

  • Purpose: reverse biobrick primer for making a reverse lac promoter.
  • Restriction sites: SpeI only.

Primers for working with biobricks

pSB1A3f1 tccttagctttcgctaagg

  • Purpose: sequencing or amplification of biobrick inserts in pSB1A3 and derivatives thereof.
  • Restriction sites: none (but amplification products will have full biobrick prefix)

pSB1A3r1 agggtggtgacaccttgc

  • Purpose: sequencing or amplification of biobrick inserts in pSB1A3 and derivatives thereof.
  • Restriction sites: none (but amplification products will have full biobrick suffix)

pSB1A2insf1 cgctaaggatgatttctgg

  • Purpose: sequencing or amplification of biobrick inserts in pSB1A2 and derivatives thereof.
  • Restriction sites: none (but amplification products will have full biobrick prefix)
  • Notes: excellent resuts for sequencing.

pSB1A2insr1 gtcagtgagcgaggaagc

  • Purpose: sequencing or amplification of biobrick inserts in pSB1A2 and derivatives thereof.
  • Restriction sites: none (but amplification products will have full biobrick suffix)
  • Notes: excellent resuts for sequencing.

bbinsertf1 attc gcggccgc t tctag

  • Purpose: sequencing or amplification of any biobrick insert
  • Restriction sites: only NotI, but amplification product will have XbaI, and SacI if present.
  • Note: gives good results for sequencing, but pSB1A2insf1 is better.

bbinsertr1 tgcag cggccgc t actag

  • Purpose: sequencing or amplification of any biobrick insert
  • Restriction sites: only NotI, but amplification product will have SpeI.
  • Note: usually not very good results for sequencing.

bbvectorf1 ag t actag ta gcggccg ctgc

  • Purpose: amplification of vector + biobrick for PCR-based cloning procedures; binds to biobrick suffix and amplifies vector region.
  • Restriction sites: SpeI, NotI; amplification product will also have PstI.

bbvectr1 cctt gagctc taga a gcggccgc gaattc

  • Purpose: amplification of vector + biobrick for PCR-based cloning procedures; binds to biobrick prefix and amplifies vector region.
  • Restriction sites: SacI, XbaI, EcoRI.


Primers for 'Bacillobrick' project

specf3 aac gagctc aacg aggt gaaa tcat g

  • Date: 22 June 2007
  • Purpose: amplification of spectinomycin resistance gene from plasmid pVK168 (Patrick Piggot, Temple U).
  • Restriction sites: SacI
  • Notes: A product was obtained (in contrast to primers specf1 and specf2, which never produced a product; these two primers were much further upstream, in the hope of including the promoter region, whereas specf3 just includes the rbs; this suggests that there is some problem with the sequence data I was given). However, numerous attempts to clone the PCR product in pGemT-easy and Edinbricks 1, 2 and 3 were unsuccessful. The reason for this is unclear. At this date (21 Aug 2007) this product has not been successfully cloned.

Primers for Bacillus subtilis ureABC genes

Primers for Escherichia coli lac genes

laczf1 cctt tctaga gg aggaaacagct atg acc

  • Date: 11 Jul 06
  • Purpose: amplification of lacZ' from E. coli BS with its native ribosome binding site (actually the rbs is slightly improved by adding 2 extra G residues at the start).
  • Restriction sites: XbaI only
  • Notes: Worked fine.

laczf2 gg tctaga gctc atgt tata tccc g

  • Date: 18 July 2006
  • Purpose: Construction of Edinbrick1 (BBa_J33207).
  • Restriction sites: XbaI, SacI
  • Notes: Puts lacZ into pSB1A2 with a SacI site overlapping the XbaI site. This allows other PCR products to be cloned in replacing the lacZ marker gene after digestion with SacI and SpeI, meaning that primers can be much shorter than if a full prefix or suffix was required. Products are fully compliant biobricks. The complementary part of this primer starts about 370 bases upstream of the start codon, so the full promoter region is present.

laczf3 gg gtcgac aggt ttccc gact g

  • Date: 18 July 2006
  • Purpose: Construction of a biobrick vector based on pT7-7.
  • Restriction sites: SalI
  • Notes: This vector was never completed. The complementary part of this primer starts 30 bases upstream of the CAP binding site, about 150 bases upstream of the start codon, so the promoter region is also included.

laczr1 aagg ctgcag cggccgc t actagt a tca ctc cag cca gct ttc

  • Date: 11 July 2006
  • Purpose: Designed to produce a truncated version of lacZ with stop codon TGA at position 77.
  • Restriction sites: PstI, NotI, SpeI
  • Notes: Also produces minor product truncated with stop codon at position 137, reason unclear. Still works fine though.

Eclacr2 gtt actagt gtgaaattgttatccgc

  • Date: 21 August 2006
  • Purpose:
  • Restriction sites: SpeI
  • Notes: Don't remember why this was made. Maybe it was to amplify the whole lacZ coding sequence rather than just the N-terminus?

XWlaczZf1 cctt tctag atg acc atg att acg gat tc

  • Date: 27 Feb 2007
  • Purpose: amplification of lacZ coding sequence (without rbs) from E. coli.
  • Restriction sites: XbaI
  • Notes:

XWlacZr1 aagg ctgcag cggccgc t actagt a tta tta ctc cag cca gct ttc c

  • Date: 27 Feb 2007
  • Purpose: amplification of lacZ coding sequence with TAA TAA double stop codon introduced after codon 76, to comply with Registry recommendations for coding sequence biobricks.
  • Restriction sites: PstI, NotI, SpeI
  • Notes:

eclacyf1 ggcgagctctgcccgtatttcgcgtaag

  • Date: 1 Sep 2006
  • Purpose: testing for presence of intact lacY in E. coli strains.
  • Restriction sites: SacI.
  • Notes: Also could be used to clone lacY as a biobrick using SacI/SpeI sites in an Edinbrick vector.

eclacyr1 gatactagtcgcgccgcatccgacattg

  • Date: 1 Sep 2006
  • Purpose: as above.
  • Restriction sites: SpeI
  • Notes: as above.

bbtagf1 gga tctaga ctagt gagc gcaa cgca atta atg

  • Date: 22 June 2007
  • Purpose: amplify lacZ' with rbs using a reverse primer such as lacZr1 with a full biobrick suffix, in order to make a cleavable lacZ tag to facilitate combining biobricks.
  • Restriction sites: XbaI, SpeI
  • Notes: Complementary part lies at the start of the CAP-binding site, about 128 bases upstream of the start codon, so the promoter region is present. Generated a good PCR product and was cloned in a suitable vector, but later I realised that cleavage at this SpeI site would generate a non-compliant biobrick lacking one of the required residues in the suffix (the T before the SpeI site). Therefore I designed primer bbtagf2, see below.

t7tagf1 ggc aat catatg ttgc ccgt ctca ctgg

  • Date: 22 June 2007
  • Purpose: Amplify lacZ for insertion into pT7-7 as a removable tag so that Sahreena could insert PCR products into pT7-7 and have a way of telling which clones had the insert by blue white selection.
  • Restriction sites: NdeI
  • Notes: The complementary region starts about 255 bases upstream of the lacZ start codon, so the promoter is included, and it will work in a strain like JM109 rather than relying on the T7 promoter in the vector. Worked fine. Insertion is between NdeI and EcoRI so that EcoRI and all other sites in the MCS are available for cloning.

t7tagr1 gaa gaat tca ctc cag cca gct ttc c

  • Date: 22 June 2007
  • Purpose: Amplify lacZ for insertion into pT7-7 as a removable tag so that Sahreena could insert PCR products into pT7-7 and have a way of telling which clones had the insert by blue white selection. A TGA stop codon (overlaps the EcoRI site) is introduced at codon 77 of lacZ.
  • Restriction sites: EcoRI
  • Notes: Worked fine.


Primers for chromogenic reporter genes

Template

primer

  • Date:
  • Purpose:
  • Restriction sites:
  • Notes:


Back to Main Page