20.109(S13):PCR and paper discussion (Day3)
Introduction
In order to select and amplify short DNA fragments from individual bacteria (or later, microsporidia), you will use the polymerase chain reaction, PCR. PCR comprises three main steps: 1) template DNA containing a desired sequence is melted, 2) primers anneal to specific locations on the now melted (i.e., single-stranded) DNA, and 3) the primers are extended by a polymerase to select and create the desired product. Extension occurs at ~70 °C, melting at ~95°C, and annealing at a temperature ~5 °C below the primer melting temperature; thus, the repetition of these steps is called thermal cycling. After each cycle, the newly formed products themselves become templates, causing exponential amplification of the selected sequence. (Note that the early rounds of PCR will not produce the desired product - we will see why in today's pre-lab lecture.)
Based on the numerous applications of PCR, it may seem that the technique has been around forever. In fact it is less than 30 years old. In 1984, Kary Mullis described this technique for amplifying DNA of known or unknown sequence, realizing immediately the significance of his insight.
"Dear Thor!," I exclaimed. I had solved the most annoying problems in DNA chemistry in a single lightening bolt. Abundance and distinction. With two oligonucleotides, DNA polymerase, and the four nucleosidetriphosphates I could make as much of a DNA sequence as I wanted and I could make it on a fragment of a specific size that I could distinguish easily. Somehow, I thought, it had to be an illusion. Otherwise it would change DNA chemistry forever. Otherwise it would make me famous. It was too easy. Someone else would have done it and I would surely have heard of it. We would be doing it all the time. What was I failing to see? "Jennifer, wake up. I've thought of something incredible." --Kary Mullis from his Nobel lecture; December 8, 1983
all or some needs to go right on D1? hard to understand primers otherwise...
We can improve the reliability and accuracy of PCR, especially important when the DNA originates from a stool sample, by two key methods. The first is the use of a highly specific polymerase, one with either explicit or inherent hot start properties. Hot start means that the polymerase is inactive at low temperature (add some further elaboration here), while the reaction is being set up and initially heated, thus reducing non-specific interactions between primers and non-target DNA. The important point to note here is that the target DNA (DNA of interest) may be present at a low concentration compared to the DNA in the sample as a whole, increasing opportunities for non-specific binding. The second performance enhancer is adding bovine serum albumin (BSA) to the PCR. As you saw if you clicked on the Kreader paper linked on Day 2, BSA itself binds many inhibitors of PCR, thus acting as a competitor with respect to the polymerase. We would much rather that inhibitors bind the BSA than bind the polymerase and interfere with its function! BSA is hydrophobic and somewhat positively charged, making it a great non-specific binder of proteins that we will use time and again in 20.109.
Even taking the above precautions, you might expect to obtain some non-specific products in your PCR today. Next time, you will run your entire reaction mixtures through a gel to visualize them, and then excise and purify the band of the correct size (~1400 bp).
Gel electrophoresis is a technique used to separate large molecules by size using an applied electrical field and appropriate sieving matrix. DNA fragments are typically separated in gels composed of agarose, a seaweed-derived polymer (see figure, below left). To prepare these gels, molten agarose is poured into a horizontal casting tray containing a comb. Once the agarose has solidified, the comb is removed, leaving wells into which the DNA sample can be loaded. The loaded DNA samples are then pulled through the matrix when a current is applied across it. Specifically, DNA molecules are negatively charged due to their phosphate backbones, and thus travel toward the positive charge at the far end of the gel (see figure, below right).
Although all DNA molecules travel in the same direction during gel electrophoresis, they do so at different rates: larger molecules get entwined in the matrix and retarded, while smaller molecules wind through the matrix more quickly and thus travel further from the well. Ultimately, fragments of similar length accumulate into “bands” in the gel. Bands of DNA are usually visualized by adding the fluorescent dye ethidium bromide (or newer alternatives such as SYBR Safe) to agarose gels. This dye intercalates between the bases of DNA, allowing DNA fragments to be located in the gel under UV light and photographed. The intensity of the band reflects the concentration of molecules that size, although there are upper and lower limits to the sensitivity of dyes. Because of its interaction with DNA, ethidium bromide is a powerful mutagen and will interact with the DNA in your body just as it does with any DNA on a gel. You should always handle all gels and gel equipment with nitrile gloves. Agarose gels with ethidium bromide must be disposed of as hazardous waste.
One parameter that affects the way DNA travels through a gel is the pore size, which is in turn affected by both the weight percent of the gel and the type of agarose used. Because we are separating large DNA fragments (> 1 Kbp) in the bacteria experiment, a low percentage (namely 1%) gel is appropriate. In the microsporidia experiment, small fragments (~ 0.1 Kbp) are expected and thus a high percentage (namely 3%) gel will be used. Specifically, we will use a high-resolution (HR) agarose; its low viscosity means that high weight percent solutions are tractable to work with, and that the solidified gel remains pliable rather than brittle. HR agarose can be prepared by chemically modifying and/or partially depolymerizing natural agarose (as described here).
You will melt the agarose gel bands, then isolate the DNA by using a silica (SiO2) column similar to the one you used last time. Salt concentration and pH effects, along with ethanol precipitation, will alternately allow for binding and eluting the DNA while washing away contaminants. The final elution here will be done in water, and these silica columns will collect any DNA between about 70 and 10,000 bp.save some of this for next time?
The PCR will run during the whole lab period. In the meantime, we will discuss a journal article, both to learn more about phylogenetic analysis and to become comfortable reading and discussing the primary scientific literature. In 2-3 weeks, you will each present an article on your own.
Protocols
Part 1: Prepare PCR to detect bacterial 16S
need to do microsporidia PCR on separate day because the Ta etc. is different --> need to find notes on where I planned to put that. possibly Day 2? primers should have arrived by then. or maybe wait until Day 4? don't want to have them balancing lab steps too soon.
- Begin by carefully labeling each PCR tube that you will use with the date, sample name, and a unique symbol and/or color for quick identification. Filling in the cap tab with your team color will usually suffice.
- Pre-chill the tubes on a cold block.
- You and your partner can now prepare and share a so-called "master mix," which contains every PCR ingredient except the template and the polymerase. Prepare enough for the number of reactions you need to run, plus an additional 10%. In addition to the two DNA-containing reactions, you should prepare a no-template control that contains pure water without any plasmid. Feel free to use the table below for your calculations.
- What do you expect to see in the no-template control case?
- When the master mix is not in use, keep it on ice.
- Combine 45 μL of master mix, 5 μL of template, and 1 μL of PfuUltra polymerase in a PCR tube. When everyone's reactions are ready, they will undergo the cycling conditions listed below.
- Add the master mix first, because the template alone may freeze. Then add template and polymerase, and finally (gently!) mix the reaction with a larger pipet.
| Reagent | Amount for 1 reaction (μL) | Amount for 3 reactions + 10% |
|---|---|---|
| PfuUltra buffer (10X stock) | 5 | |
| Primer mix | 1 | |
| dNTPs | 1 | |
| 10% [5%?] BSA (100X stock) | 0.5 | |
| Water | 32.5 | |
| DNA template | 5 | N/A |
| Segment | Cycles | Temperature (° C) | Time |
|---|---|---|---|
| 1 | 1 | 95 | 5 min |
| 2-4 | 35 | 95 | 1 min |
| 51 | 1 min | ||
| 72 | 2 min | ||
| 5 | 1 | 72 | 10 min |
| 6 | 1 | 4 | indefinite |
Part 2: WAC Session
Today you will hear a lecture on preparing your journal club presentations.
Part 3: Journal article discussion
Scientific papers are dense and often time-consuming to read and understand, but with practice, you will find strategies that improve your comprehension efficiency. Here's one tip to get you started: when reading newly reported results, be sure to refer to the associated figures frequently, because visual information is often easier to take in than purely verbal descriptions.
Technical Background
Discussion Topics
Writing
As you read the paper by WHOEVER, consider not only its scientific content, but also the authors' writing style (perhaps not all on one read!). Sketch out answers to the questions below (right on the paper if you wish). Your answers will not be collected, but you may be called on in discussion to share your ideas.
Content
Probably changing to assigning these in advance and doing slightly more formal presentation (single slide prepared)
When you arrive in lab today, each group will be assigned one of the following topics to present to and discuss with the rest of the class. You should be somewhat familiar with the whole WHOEVER paper by now, but will have some time in-class to refresh your memory and become the resident expert in one of the following areas.
For next time
Reagent list
- PfuUltra polymerase and buffer from Agilent
- Primers
- intermediate stock concentration is 5 μM for each primer (5 μM total), diluted from individual 100 μM long-term stocks
- F8-27 sequence: 5' AGAGTTTGATCCTGGCTCAG
- R1392-1407 sequence: 5' ACGGGCGGTGTGTACA