IGEM:IMPERIAL/2007/Projects/Cell by date/Implementation/List of Required Parts
From OpenWetWare
DNA Constructs
pTet GFP
- Registry part: BBa_I13522
- Comments: Untagged GFP behind a constitutive promoter.
- DNA Available in the registry
pT7 GFP
- Registry part: BBa_J34814
- T7 promoter sequence: gaatttaatacgactcactatagggaga
- Comments: T7 Promoter to be used qith t7 polymerase BBa_J34811
- DNA still in planning
- pT7 sequence from Ambion:
pBad GFP
- Registry part: BBa_J5528
- Comments: Similar to part J5527 where mRFP is replaced with GFP
- DNA Available in the registry
- Allows tight control in E. coli
Generic Components
- RBS (Elowitz)
Short description: This is the most efficient RBS in the registry, and sets the 1.0 efficiency standard. It is based on the Elowitz repressilator.
- Double terminator (B0010-B0012)
Short description: Double terminator consisting of BBa_B0010 and BBa_B0012. This is the most commonly used terminator. It seems to be reliable.
-forward_efficiency: 0.984
-reverse_efficiency: 0.295
Other Materials
- DsRed-Express
- T7 RNApol
Short description: To be used with specal tRNA loading glutamate instead of stop codon (Part BBa_J34812).
- tRNA loading Glutamate on stop codon TTT
