Wikiomics:Cloning in silico

From OpenWetWare
Revision as of 14:34, 13 December 2007 by Darek Kedra (talk | contribs) (CAP3 plus)
Jump to navigationJump to search
The printable version is no longer supported and may have rendering errors. Please update your browser bookmarks and please use the default browser print function instead.

Cloning in silico proceduro of obtaining full or partial cDNA sequence of a gene by using computer only.

There are several variants:

  • discovery of new splice forms of a known gene
  • cloning a novel orthologue gene in new species
  • cloning a new gene(s) using ESTs database alone (ESTs clustering)


ESTs based

databases of pre-clustered ESTs

A shortcut to obtain either consensus sequence (TIGR) or a set of ESTs (Unigene) derived from a gene of interest.

  • STACKdb (limited access, tissue specific splice forms) [1]
  • Unigene (no consensus sequence) [2]
  • TIGR [3]

Search of ESTs databases using BLAST

  1. Depending on a level of homology we can use:
  • blastn program, cDNA sequence as query, EST DB from the same species (== novel splice forms discovery in the same species)
  • tblastn program, protein sequence as query, EST DB from the same (==paralogue discovery) or other species (== cloning any homologues)

If possible, use protein sequence from related species i.e zebrafish protein when looking for a homologue in salmon), but for a large number number of proteins one can detect homology between human and C.elegans.

  1. Restrict blast output with species, i.e search only porcine ESTs to simplify the output
  2. On the BLAST output page select reasonable hits by checking box on the left in the alignment section.
  3. Retrieve all checked results as FASTA file (i.e. pig_Xgene_ESTs_date_round1.fasta
  4. check how many sensible hits you got, i.e. using grep on Unix/Linux
grep '>' pig_Xgene_ESTs_date_round1.fasta | wc 
  1. assembly all your EST sequences using phrap (on Unix command line):
phrap pig_Xgene_ESTs_date_round1.fasta

you should get file: pig_Xgene_ESTs_date_round1.fasta.contigs


If you do not have phrap you may use:

  • CAP3
  • ESSEM (Est's aSSEmbly using Malig) from Technical University of Catalonia.

You may download sequences of human SYNGR4 [ESTs http://www.ncbi.nlm.nih.gov/UniGene/clust.cgi?UGID=221005&TAXID=9606&SEARCH= here], save it as FASTA file and then feed CAP3 or ESSEM with it to check how it works. Use Suggested assembly sequence:

>assembly: gnl|UG|Hs# -> gnl|UG|Hs# (R)
TTTTTTTTTTTTTTTGTTTTTAGAAACCCTTCTGGAGGGAGGATTCTCTCTTTATTGATTTGGATAAGGATATTTAGTTG
TCAGGCATCATAGCAAGCCGGGGGGACTTTGGAGCGGTCAGACAGGGGGACAGGGCAGAGCTAGCATAACTCAGGCTGTT
GGGGCCAGTGGTGGGCATGTTCACAGGGCTGTTGGCAGAGGGCAAGGGGAGGGTGGTCAGCACCATGCCACCCTCATCCA
GGAAGCGCTTGTAAGGGACTGGAGCATCATTTCGGAGGTCCTGGAATGCCAGGTAGGCCTGGAATATCCAGACAAGGATG
GAGAAGAAGGTGAAGGCGATGGCTGCCTGGCACTGCTGCTCCCCAGGAGGAACTCTTTGGGCGGCGAATGCTGCCATTGG
TTGGCCAGGAAGCAGAAACCCATGAACCAGACAACTGCCCAGAGAACAGCCAGGATGAAGTCCAGGAGCTGGAAGGCTGT
CTTGAAGCGGGTGCCGGCAATGCGGGTCTCCTGTGTGTCCAGGACGAGGAAGGCCAGCCACGCTGAGGAAGGCCAGGAAG
CCGGCTCCCACGGCAAAGCTGCAGGCCACGCTGTTGCTGTTGAGAATGCAGTGGAGCTGCGGAGACTCCATCTTGTTCTG
GTAGCCGTCGGTCAGCAGGGAGGAGAAGACGATCAGGGAGAAGACCCCTGCCTCCCCCACACTCTCCTTCTGCCACCAAA
CC
  1. mask possible repeats using RepeatMasker server. ESTs libraries are notorious for containing non-spliced ESTs/containations.
  1. use masked consensus sequence (MCS) from step above in next round of BLAST search:

in blastn program, MCS as query, EST DB from the same species

check how many sensible hits you got.

  1. repeat ESTs assembly, repeat masking, compare new ESTs contigs with contigs from the previous step until you got no new hits in ESTs database.
  2. after every assembly step make sure that the contig you use contains sequence of interest (== compare it with the first cDNA or protein sequence)


Genome annotation using ESTs assembly



importing human, mouse and zebrafish EST trace files

For a significant subset of human, mouse and zebrafish ESTs there are available trace and even experiment files. For a sane gene cloning we need them because:

  • sequences in GeneBank are usually shorter than original trace files
  • there is no way you can detect a sequencing error in plain text/fasta file without looking at trace file

In order to get them one can search for relevant trace files using Sanger's Trace server:

http://trace.ensembl.org/cgi-bin/tracesearch

Genome based

  • based on homology
  • de novo

This will be covered in genome annotation guide.