SBB09 Oligos

From OpenWetWare
Revision as of 18:10, 9 February 2009 by Hank Shih (talk | contribs)
Jump to navigationJump to search

Put your oligo sequences into this page. Separate each column with tabs:

ca998	Forward Sequencing of pSB1A2/pSB1A3	gtatcacgaggcagaatttcag
G00101	Reverse sequencing of pSB1A* plasmids	attaccgcctttgagtgagc
Ost001F	Forward oligo for upaG	ccaaaGAATTCatgAGATCTgttgagatggataacaaactg
Ost002R	Reverse oligo for upaG	ctagcGGATCCttaCCACtgaataccggcaccgag
Ost003F	Forward construction for HydroxyapatiteBP	ccaaaGAATTCatgAGATCTgcgccgtggcatctgagcagccagtatag
Ost004R	Reverse construction for HydroxyapatiteBP	ctagcGGATCCggtgcggctatactggctgctcagatgc
Bso001 Cloning of Autotransporter  ccataGAATTCatgAGATCTggctggcaggtcgtcaag
Bso002 Cloning of Autotransporter  GCTAGggatccTCAatcagctttaccctccac
Bso003 Cloning of PL2_Passenger_AT to Autotransporter  ccataGAATTCatgAGATCTtgccggcggcgaccagactgtac
Bso004 Cloning of PL2_Passenger_AT to Autotransporter  gctagGGATCCatcagctttaccctccac
Ojb001F        Forward construction of CPG_L2 N term part         ctctgGAATTCatgAGATCTgaggaaaggaacgactgg
Ojb001R        Reverse construction of CPG_L2 N term part          catgtGGATCCttacgcgctataatctaccggcc
Ojb002F        Forward construction of CPG_L2 C term part         ctctgGAATTCatgAGATCTatgggtaaacgtggaacgtggtt
Ojb003F        Forward removal of XhoI site in CPG_L2                  actattatctTgagcgcggc
Ojb003R        Reverse removal of XhoI site in CPG_L2                  gccgcgctcAagataatagt
Ojb002R        Reverse construction of CPG_L2 C term part          catgtGGATCCgaacgagtaatttacgccga
Ojb004F        Forward SOEing oligo for CPG_L2                        GGATCTAAGTCTCGTCGCgaggaaaggaacgactggca
Ojb004R        Reverse SOEing oligo for CPG_L2                        GCGACGAGACTTAGATCCgaacgagtaatttacgccga
Ojb005F        Forward construction of CPG_L6 N term part          ctctgGAATTCatgAGATCTgaggaaaggaacgactgg
Ojb005R        Reverse construction of CPG_L6 N term part     catgtGGATCCttactgccagtcccagttactcc
Ojb006F        Forward construction of CPG_L2 C term part        ctctgGAATTCatgAGATCTatggatgatattgaacgtgaagg
Ojb006R        Reverse construction of CPG_L2 C term part       catgtGGATCCgaacgagtaatttacgccga
hs018F  Forward EcoRI for a~eaeA_Display>           cccaaGAATTCatgAGATCTtaacATGATTACTCATGGTTG
hs019F  Removing the EcoRI site from eaeA_Display   GTTAATCAGAATTtATTTGCAAATG
hs019R  Removing the EcoRI site from eaeA_Display   CATTTGCAAATaAATTCTGATTAAC
hs020R  Reverse BamHI for a~eaeA_Display>           GCAAAggatccGCCTTGGTTTGATCAA