User:Torsten Waldminghaus/qPCR-Primers

• All primers are in concentrations of 100pmol/μL

Name	Sequence	Characteristics	Probe set number
uvrDfw	AGTTCCCGCAGGTGTTTATC	qPCR for uvrD-region on E. coli chromosomewith no GATC-sites (Region B from [1])	1
uvrDrv	GTCAGCGTCAGTTTCTGCAT	qPCR for uvrD-region on E. coli chromosomewith no GATC-sites (Region B from [1])	1
uvrDprobe	AGACGCCCGCCTTCATCCAG	HPLC-pure 5'Fam - 3'Tamra qPCR for uvrD-region on E. coli chromosome with no GATC-sites (Region B from [1]	1
yahEFfw	CCATCGAGACGATCAAAGAA	qPCR for yahEF-region on E. coli chromosome with many GATC-sites (Region 2 from [1])	2
yahEFrv	CAGCATCTGGCTTTGTTGTT	qPCR for yahEF-region on E. coli chromosome with many GATC-sites (Region 2 from [1])	2
yahEFprobe	AACTCGCGTCCTTCGGCAGC	HPLC5'Fam - 3'Tamra qPCR for yahEF-region on E. coli chromosome with many GATC-sites (Region 2 from [1])	2
cluster-fw	CTGACTGATGAGATCCAACGA	qPCR for GATC-cluster	14
cluster-rv	CTGGTGCTACGCCTGAATAA	qPCR for GATC-cluster	14
cluster-p	AAATTCGACCCGGCTGTCGC	HPLC-pure 5'Fam - 3'Tamra qPCR for GATC-cluster	14
761139p	CCAGGAAGCCCACGGATTCG	HPLC-pure 5'Fam - 3'Tamra qPCR for sucB-region on E. coli chromosome with many GATC-sites	6
761139fw	GAGATCCTGCCGATGATGTA	qPCR for sucB-region on E. coli chromosome with many GATC-sites	6
761139rv	TTCCAGCAACTCTTTGATCG	qPCR for sucB-region on E. coli chromosome with many GATC-sites	6
797735fw	CGTCCTGGCGTATCGTATC	qPCR for pgl-region on E. coli chromosome with isolated GATC-site	4
797735rv	GCATTGTAAGAACCTACAAAGACAA	qPCR for pgl-region on E. coli chromosome with isolated GATC-site	4
797735p	TTTGCCGCAGAGTCTGCGCT	HPLC-pure 5'Fam - 3'Tamra qPCR for pgl-region on E. coli chromosome with isolated GATC-site	4
1504230fw	CGCCTTCAGTTTATGATCCA	qPCR for ydcN-region on E. coli chromosome with many GATC-sites	13
1504230rv	TCGAGAAGTGTTCAAAGCAGA	qPCR for ydcN-region on E. coli chromosome with many GATC-sites	13
1504230p	TGATCACCATCGCCTGCTGTTG	HPLC-pure 5'Fam - 3'Tamra qPCR for ydcN-region on E. coli chromosome with many GATC-sites	13
1514191fw	ATACTGTTTGGCAGAGGCAA	qPCR for ydcW-region on E. coli chromosome with isolated GATC-site	12
1514191rv	GGTATGGCTGATGATGTGCT	qPCR for ydcW-region on E. coli chromosome with isolated GATC-site	12
1514191p	TGACCGGTCAGCGGATCACC	HPLC-pure 5'Fam - 3'Tamra qPCR for ydcW-region on E. coli chromosome with isolated GATC-site	12
2318305fw	ATAATCACCTACGCGCCTTC	qPCR for atoSC-region on E. coli chromosome with isolated GATC-site	5
2318305rv	ACCTGCCTGCCTGAATAAAC	qPCR for atoSC-region on E. coli chromosome with isolated GATC-site	5
2318305p	TGCCGCAGATCACCCTGGTC	HPLC-pure 5'Fam - 3'Tamra qPCR for atoSC-region on E. coli chromosome with isolated GATC-site	5
2351285fw	ACACATTGCCGAATATGCC	qPCR for glpAB-region on E. coli chromosome with many GATC-sites	16
2351285rv	GTTAATGCGGTGATCCATGA	qPCR for glpAB-region on E. coli chromosome with many GATC-sites	16
2351285p	CTGCGCATTCGCATGTTCCC	HPLC-pure 5'Fam - 3'Tamra qPCR for glpAB-region on E. coli chromosome with many GATC-sites	16
2923803fw	GTCAGCCACCTGCTGAAAT	qPCR for queF-region on E. coli chromosome with isolated GATC-site	15
2923803rv	ATACTGAATTTGGAGCGAACC	qPCR for queF-region on E. coli chromosome with isolated GATC-site	15
2923803p	TGCCTGATCACCCATCAACCAGA	HPLC-pure 5'Fam - 3'Tamra qPCR for queF-region on E. coli chromosome with isolated GATC-site	15
2952960fw	CTACTGTTTCGCGGATCTCA	qPCR for recD-region on E. coli chromosome with many GATC-sites	8
2952960rv	CAACTGCTTGCAGAACCATT	qPCR for recD-region on E. coli chromosome with many GATC-sites	8
2952960p	CTGGTGATCACCCGCGCATT	HPLC-pure 5'Fam - 3'Tamra qPCR for recD-region on E. coli chromosome with many GATC-sites	8
3923874fw	GCCCTGTGGATAACAAGGAT	qPCR for oriC-region on E. coli chromosome with many GATC-sites	18
3923874rv	CCTCATTCTGATCCCAGCTT	qPCR for oriC-region on E. coli chromosome with many GATC-sites	18
3923874p	CGGTCCAGGATCACCGATCATTC	HPLC-pure 5'Fam - 3'Tamra qPCR for oriC-region on E. coli chromosome with many GATC-sites	18
3921366fw	GAGAATATGGCGTACCAGCA	qPCR for gidB-region on E. coli chromosome with isolated GATC-site	7
3921366rv	AAGACGCAGGTATTTCGCTT	qPCR for gidB-region on E. coli chromosome with isolated GATC-site	7
3921366p	CAACCTGACTTCGGTCCGCG	HPLC-pure 5'Fam - 3'Tamra qPCR for gidB-region on E. coli chromosome with isolated GATC-site	7
4301774fw	CTGAATAACTCGCCTCGTGA	qPCR for mdtO-region on E. coli chromosome with isolated GATC-site	10
4301774rv	ATTCCCGTCTTCATGGTTTC	qPCR for mdtO-region on E. coli chromosome with isolated GATC-site	10
4301774p	TAAGCGCCGATCACCGGGAT	HPLC-pure 5'Fam - 3'Tamra qPCR for mdtO-region on E. coli chromosome with isolated GATC-site	10
4321507fw	AGCCAGAGGTGGAGTTAGGA	qPCR for phnD-region on E. coli chromosome with many GATC-sites	9
4321507rv	ACAACCTGAACGATCTGCTG	qPCR for phnD-region on E. coli chromosome with many GATC-sites	9
4321507p	TCTCACCTTTGGCAATGGCGA	HPLC-pure 5'Fam - 3'Tamra qPCR for phnD-region on E. coli chromosome with many GATC-sites	9
ter-fw	TCCTCGCTGTTTGTCATCTT	qPCR for ter-region (ydeE cds) on E. coli chromosome with isolated GATC-site	17
ter-rv	GGTCTTGCTCGAATCCCTT	qPCR for ter-region (ydeE cds) on E. coli chromosome with isolated GATC-site	17
ter-p	CATCAGCACCCACGCAGCAA	HPLC-pure 5'Fam - 3'Tamra qPCR for ter-region (ydeE cds) on E. coli chromosome with isolated GATC-site	17
datA-fw	CAAGCTGTGGATGAATCAGG	qPCR for datA-region on E. coli chromosome (region contains HphI site that does not overlap GATC so it can be used as control in methylation analysis)	19
datA-rv	AAATGCGTGCATAGTCGAAG	qPCR for datA-region on E. coli chromosome (region contains HphI site that does not overlap GATC so it can be used as control in methylation analysis)	19
datA-p	CAATCACCCGAACCAGACGCTG	qPCR for datA-region on E. coli chromosome (region contains HphI site that does not overlap GATC so it can be used as control in methylation analysis)	19

1. Yamazoe M, Adachi S, Kanaya S, Ohsumi K, and Hiraga S. Sequential binding of SeqA protein to nascent DNA segments at replication forks in synchronized cultures of Escherichia coli. Mol Microbiol. 2005 Jan;55(1):289-98. DOI:10.1111/j.1365-2958.2004.04389.x |