MurrayRM:PURExpress system notes and experience

From OpenWetWare
Revision as of 18:56, 12 February 2010 by Murrayrm (talk | contribs) (LCL3)
Jump to navigationJump to search
The printable version is no longer supported and may have rendering errors. Please update your browser bookmarks and please use the default browser print function instead.

Notes on using the NEB PURExpress system.

Worked example: inducible expression

To illustrate how the system works, this section describes an experiment to test out four different constructs:

  • PLG1 (BBa_I2035) - GFP with a LacI-repressible promoter on a plasmid (fluoresce)
  • LLG2 (T7-Plac:RBS:GFP) - linear DNA with GFP on a LacI-repressible promoter, PCR'd from BBa_I2035 (fluoresce)
  • LLG2 + LCL3 (T7:RBS:lacI) - linear GFP on a LacI-repressible promoter with linear lacI on a constitutive T7 promoter (no fluorescense)
  • LLG2 + LCL3 + 100 uM IPTG - GFP on a LacI-repressible promoter with lacI and IPTG present (fluoresce)

In addition, an RFP-based construct was developed, just in case I couldn't get access to BBa_I2035 and a constitutive T7-based lacI using a biobrick part:

  • PLR4 (T7-Plac:RBS:RFP) - plasmid DNA with RFP on a LacI-repressible promoter, PCR'd from plasmid provided by Karsten Temme at UCSF and inserted into Novagen pET vector. This can be used as a replacement for LLG2, if needed.
  • LCL5 (T7-RBS:lacI) - linear DNA with with LacI on a constitutive T7 promoter, constructed from BBa_2043. This can be used as a replacement for LCL3, if needed.

Naming scheme:

  • L/P - DNA type: linear DNA versus plasmid
  • C/L - promoter type: constitutive T7 promoter versus LacI-repressible
  • G/L/R - coding region: GFP, RFP or LacI

DNA construction

Only the BBa_I2035 plasmid is in the form needed for use with the PURE system. The other sequences were constructed using PCR-based editing.

PLG1

This construct is part of the biobricks library and will be obtained from freezer stocks at Stanford (e-mail to Drew on 12 Feb confirming existence).

LLG2

This is linear DNA containing a lacI-repressible T7 promoter in front of GFP, extracted from BBa_I2035 using a simple forward and reverse primer. Use of this piece of DNA allows testing of linear DNA versus plasmid DNA.

The sequence for the relevant section of BBa_I2035, starting from the beginning of the promoter and going through the end of the terminator

>BBa_I2035 Part-only sequence (856 bp) tcatacgactcactataggggaattgtgagcggataacaattcccctggatcctactagagtcacacaggaaagtactagatgcgtaaaggagaagaact tttcactggagttgtcccaattcttgttgaattagatggtgatgttaatgggcacaaattttctgtcagtggagagggtgaaggtgatgcaacatacgga aaacttacccttaaatttatttgcactactggaaaactacctgttccatggccaacacttgtcactactttcggttatggtgttcaatgctttgcgagat acccagatcatatgaaacagcatgactttttcaagagtgccatgcccgaaggttatgtacaggaaagaactatatttttcaaagatgacgggaactacaa gacacgtgctgaagtcaagtttgaaggtgatacccttgttaatagaatcgagttaaaaggtattgattttaaagaagatggaaacattcttggacacaaa ttggaatacaactataactcacacaatgtatacatcatggcagacaaacaaaagaatggaatcaaagttaacttcaaaattagacacaacattgaagatg gaagcgttcaactagcagaccattatcaacaaaatactccaattggcgatggccctgtccttttaccagacaaccattacctgtccacacaatctgccct ttcgaaagatcccaacgaaaagagagaccacatggtccttcttgagtttgtaacagctgctgggattacacatggcatggatgaactatacaaataataa tactagagctagcataaccccttggggcctctaaacgggtcttgaggggttttttg

  • Forward primer: tcatacgactcactataggggaat
  • Reverse primer: aaacgggtcttgaggggttttttg

LCL3

This sequence consists of lacI on a constitutive T7-promoter. It is constructed by doing PCR amplification of lacI out of a BBa_I2043 plasmid and then attaching the T7 promoter and RBS using the PURExpress universal primer. Sequence for lacI (from BBa_K091121 - wild type lacI):

>BBa_K091121 Part-only sequence (1083 bp) atgaaaccagtaacgttatacgatgtcgcagagtatgccggtgtctcttatcagaccgtttcccgcgtggtgaaccaggccagccacgtttctgcgaaaa cgcgggaaaaagtggaagcggcgatggcggagctgaattacattcccaaccgcgtggcacaacaactggcgggcaaacagtcgttgctgattggcgttgc cacctccagtctggccctgcacgcgccgtcgcaaattgtcgcggcgattaaatctcgcgccgatcaactgggtgccagcgtggtggtgtcgatggtagaa cgaagcggcgtcgaagcctgtaaagcggcggtgcacaatcttctcgcgcaacgcgtcagtgggctgatcattaactatccgctggatgaccaggatgcca ttgctgtggaagctgcctgcactaatgttccggcgttatttcttgatgtctctgaccagacacccatcaacagtattattttctcccatgaagacggtac gcgactgggcgtggagcatctggtcgcattgggtcaccagcaaatcgcgctgttagcgggcccattaagttctgtctcggcgcgtctgcgtctggctggc tggcataaatatctcactcgcaatcaaattcagccgatagcggaacgggaaggcgactggagtgccatgtccggttttcaacaaaccatgcaaatgctga atgagggcatcgttcccactgcgatgctggttgccaacgatcagatggcgctgggcgcaatgcgcgccattaccgagtccgggctgcgcgttggtgcgga tatctcggtagtgggatacgacgataccgaagacagctcatgttatatcccgccgttaaccaccatcaaacaggattttcgcctgctggggcaaaccagc gtggaccgcttgctgcaactctctcagggccaggcggtgaagggcaatcagctgttgcccgtctcactggtgaaaagaaaaaccaccctggcgcccaata cgcaaaccgcctctccccgcgcgttggccgattcattaatgcagctggcacgacaggtttcccgactggaaagcgggcagtga

  • Round 1 forward primer: atgaaaccagtaacgttatacg
  • Round 1 reverse primer: atgaaaccagtaacgttatacg
  • Round 2 forward primer: PURExpress universal forward primer
  • Round 2 reverse primer: same as round 1 reverse primer

PLR4

This is a linear sequence of DNA that can be used as a replacement for LLG2, in case I can't get BBa_I2035. In order to get this sequence, I have to insert RFP into a pET vector (has a lacI-repressible T7 promoter) and grow up some cells.

LCL5

This is a substitute for LCL3 using the Novagen pLacI plasmid (in case I can't get BBa_I2043). The primers are identical to LCL3 since we are just grabbing a standard lacI gene. (Note: need to check there are no modifications to the sequences on the pLacI plasmid; if so, look for another source).