MurrayRM:PURExpress system notes and experience

From OpenWetWare
Revision as of 00:00, 13 February 2010 by Murrayrm (talk | contribs) (PLG1)
Jump to navigationJump to search

Notes on using the NEB PURExpress system.

Worked example: inducible expression

To illustrate how the system works, I am going to try various combinations of three different constructs:

  • PLG1 (BBa_I2035) - GFP with a LacI-repressible promoter on a plasmid
  • LLG2 (T7-Plac:RBS:GFP) - linear DNA with GFP on a LacI-repressible promoter, PCR'd from BBa_I2035
  • LCL3 (T7:RBS:lacI) - linear lacI on a constitutive T7 promoter

In addition, I may build up an RFP-based construct, just in case I can't get access to BBa_I2035. This requires two additional constructs:

  • LLR4 (T7-Plac:RBS:RFP) - linear DNA with RFP on a LacI-repressible promoter, PCR'd from the purified RFP plasmid (based on plasmids provided by Karsten Temme at UCSF), created by extension PCR
  • PLR5 (T7-Plac:RBS:RFP) - plasmid DNA with RFP on a LacI-repressible promoter, PCR'd from the purified RFP plasmid (based on plasmids provided by Karsten Temme at UCSF) and inserted into Novagen pET vector. This can be used as a replacement for PLG1, if needed.

Naming scheme:

  • L/P - DNA type: linear DNA versus plasmid
  • C/L - promoter type: constitutive T7 promoter versus LacI-repressible
  • G/L/R - coding region: GFP, RFP or LacI

Using these components, I can try out the following "circuits":

  • GFP expression on a lacI-repressible T7 promoter (with no lacI => should flouresence): PLG1 or LLG2
This will allow a positive control to make sure that a T7 promoter with operator site still works
  • Repression of GFP by lacI: PLG1/LLG2 + LCL3
  • Induction of GFP using IPTG: PLG1/LLG2 + LCL3

DNA construction

Only the BBa_I2035 plasmid is in the form needed for use with the PURE system. The other sequences will be constructed using PCR-based editing.

PLG1 - plasmid LacI-repressible GFP

This construct is part of the biobricks library and will be obtained from freezer stocks at Stanford (e-mail to Drew on 12 Feb confirming existence).

LLG2

This is linear DNA containing a lacI-repressible T7 promoter in front of GFP, extracted from BBa_I2035 using a simple forward and reverse primer. Use of this piece of DNA allows testing of linear DNA versus plasmid DNA.

The sequence for the relevant section of BBa_I2035, starting from the beginning of the promoter and going through the end of the terminator

>BBa_I2035 Part-only sequence (856 bp) tcatacgactcactataggggaattgtgagcggataacaattcccctggatcctactagagtcacacaggaaagtactagatgcgtaaaggagaagaact tttcactggagttgtcccaattcttgttgaattagatggtgatgttaatgggcacaaattttctgtcagtggagagggtgaaggtgatgcaacatacgga aaacttacccttaaatttatttgcactactggaaaactacctgttccatggccaacacttgtcactactttcggttatggtgttcaatgctttgcgagat acccagatcatatgaaacagcatgactttttcaagagtgccatgcccgaaggttatgtacaggaaagaactatatttttcaaagatgacgggaactacaa gacacgtgctgaagtcaagtttgaaggtgatacccttgttaatagaatcgagttaaaaggtattgattttaaagaagatggaaacattcttggacacaaa ttggaatacaactataactcacacaatgtatacatcatggcagacaaacaaaagaatggaatcaaagttaacttcaaaattagacacaacattgaagatg gaagcgttcaactagcagaccattatcaacaaaatactccaattggcgatggccctgtccttttaccagacaaccattacctgtccacacaatctgccct ttcgaaagatcccaacgaaaagagagaccacatggtccttcttgagtttgtaacagctgctgggattacacatggcatggatgaactatacaaataataa tactagagctagcataaccccttggggcctctaaacgggtcttgaggggttttttg

  • RMM_LLG2_fwd: tcatacgactcactataggggaat
  • RMM_LLG2_rev: caaaaaacccctcaagacccgttt

LCL3

This sequence consists of lacI on a constitutive T7-promoter. It is constructed by doing PCR amplification of lacI out of a BBa_K091121 plasmid and then attaching the T7 promoter and RBS using the PURExpress universal primer. Sequence for lacI (from BBa_K091121 - wild type lacI):

>BBa_K091121 Part-only sequence (1083 bp) atgaaaccagtaacgttatacgatgtcgcagagtatgccggtgtctcttatcagaccgtttcccgcgtggtgaaccaggccagccacgtttctgcgaaaa cgcgggaaaaagtggaagcggcgatggcggagctgaattacattcccaaccgcgtggcacaacaactggcgggcaaacagtcgttgctgattggcgttgc cacctccagtctggccctgcacgcgccgtcgcaaattgtcgcggcgattaaatctcgcgccgatcaactgggtgccagcgtggtggtgtcgatggtagaa cgaagcggcgtcgaagcctgtaaagcggcggtgcacaatcttctcgcgcaacgcgtcagtgggctgatcattaactatccgctggatgaccaggatgcca ttgctgtggaagctgcctgcactaatgttccggcgttatttcttgatgtctctgaccagacacccatcaacagtattattttctcccatgaagacggtac gcgactgggcgtggagcatctggtcgcattgggtcaccagcaaatcgcgctgttagcgggcccattaagttctgtctcggcgcgtctgcgtctggctggc tggcataaatatctcactcgcaatcaaattcagccgatagcggaacgggaaggcgactggagtgccatgtccggttttcaacaaaccatgcaaatgctga atgagggcatcgttcccactgcgatgctggttgccaacgatcagatggcgctgggcgcaatgcgcgccattaccgagtccgggctgcgcgttggtgcgga tatctcggtagtgggatacgacgataccgaagacagctcatgttatatcccgccgttaaccaccatcaaacaggattttcgcctgctggggcaaaccagc gtggaccgcttgctgcaactctctcagggccaggcggtgaagggcaatcagctgttgcccgtctcactggtgaaaagaaaaaccaccctggcgcccaata cgcaaaccgcctctccccgcgcgttggccgattcattaatgcagctggcacgacaggtttcccgactggaaagcgggcagtga

  • RMM_LCL3_fwd_round1: TAACTTTAAGAAGGAGATATACCA atgaaaccagtaacgttatacg
    • Based on specification in PURExpress manual, with start of lacI
  • RMM_LCL3_rev_round1: TATTCA tcactgcccgctttccagt
    • Based on specification in PURExpress manual
  • Round 2 forward primer: PURExpress universal forward primer
  • Round 2 reverse primer: same as round 1 reverse primer

LLR4

A linear sequence of DNA with a T7 LacI-repressible promoter followed by RBS and RFP. This will be constructed using PCR extension off of RFP.

RFP sequence (for Karsten's plasmid)

gaagacgttatcaaagagttc atgcgtttcaaagttcgtatggaaggttccgttaacggtcacgagttcgaaatcgaaggtgaaggtgaaggtcgtccgtacgaaggtacccagaccgctaaactgaaagtta ccaaaggtggtccgctgccgttcgcttgggacatcctgtccccgcagttccagtacggttccaaagcttacgttaaacacccggctgacatcccggactacctgaaactgtcct tcccggaaggtttcaaatgggaacgtgttatgaacttcgaagacggtggtgttgttaccgttacccaggactcctccctgcaagacggtgagttcatctacaaagttaaactgc gtggtaccaacttcccgtccgacggtccggttatgcagaaaaaaaccatgggttgggaagcttccaccgaacgtatgtacccggaagacggtgctctgaaaggtgaaatca aaatgcgtctgaaactgaaagacggtggtcactacgacgctgaagttaaaaccacctacatggctaaaaaaccggttcagctgccgggtgcttacaaaaccgacatcaaact ggacatcacctcccacaacgaagactacaccatcgttgaacagtacgaacgtgctgaaggtcgtcactccaccggtgcttaataa

T7:Plac:RBS sequence

tcatacgactcactataggggaattgtgagcggataacaattcccctggatcctactagagtcacacaggaaagtactag

  • RMM_LLR4_fwd: tcatacgactcactataggggaattgtgagcggataacaattcccctggatcctactagagtcacacaggaaagtactag atgcgtttcaaagttcgtatgg
    • Does not include the GAAAT sequence that is at the start of the PURE universal primer
  • RMM_LLR4_rev: TATTCA ttattaagcaccggtggagtgac
    • Initial sequence based on specification in PURExpress manual

Alternative: do in two rounds

  • RMM_LLR4_fwd_round1: tactagagtcacacaggaaagtactag atgcgtttcaaagttcgtatgg (49 bp, 41% GC)
    • Starts just after the lacI operator sites and goes through RBS, then beginning of RFP
  • RMM_LLR4_fwd_round2: tcatacgactcactataggggaattgtgagcggataacaattcccctggatcc tactagagtcacacagg (70 bp, 47% GC)
    • Includes the T7 promoter, through the lacI operator site and overlaps with the RBS sequence

PLR5

This is a linear sequence of DNA that can be used as a replacement for LLG2, in case I can't get BBa_I2035. In order to get this sequence, I have to insert RFP into a pET vector (has a lacI-repressible T7 promoter) and grow up some cells.

  • Restriction enzymes to be used: TBD (waiting to find out which pET vectors we actually have available)
  • BamH1: GGATCC
  • XhoI: CTCGAG
  • RMM_PLR5_fwd_BamH1: GGAA GGATCC atgcgtttcaaagttcg
    • Added GGAA to end of sequence per Simon
  • RMM_PLR5_rev_XhoI: GGAA CTCGAG ttattaagcaccggtggagt
    • Added GGAA to end of sequence per Simon

LCR6

This is a linear sequence of DNA that pulls out RFP for use in the PURE system. Replacement for previous sequence that was not quite right.

  • RMM_LCR6_fwd_round1: TAACTTTAAGAAGGAGATATACCA atgcgtttcaaagttcg (41 bp, 34% GC)
  • RMM_LCR6_rev_round1: TATTCA ttattaagcaccggtggag (25 bp, 40% GC)