SBB10Ntbk-ZhenZongHuang

Zhen Z. Huang 13:30, 22 February 2010 (EST)

I prepared analytical gel for sbb31.

Sbb31 -- Zymol Clean up Sbb15 -- Small Zymol Clean up

Put both pure product in box A.

Zhen Z. Huang 16:05, 17 February 2010 (EST)

Wed, Feb 17th, 2010

I prepared a PCR reaction for sbb31 and a wobble reaction for sbb15.

sbb31

Regular PCR

I made The oligo concentrations of 100uM for ZHH001 and ZHH002 by adding the right amount of DDH20. Then I made oligo dilution of with 9uL Water and 1uL 100uM of the oligos to make 10uM.

I added the following into a PCR tube in the following order:

1. 24uL ddH2O
2. 3.3uL 10x Expand Buffer "2"
3. 3.3uL dNTPs (2mM in each)
4. 1uL Oligo 1, 10uM
5. 1uL Oligo 2, 10uM
6. 0.5uL Expand polymerase "1"
7. 0.5uL Template DNA

I put the the PCR tube in the 2K55 ice bucket.

sbb15

Wobble

I made The oligo concentrations of 100uM for ZHH003 and ZHH004 by adding the right amount of DDH20

I added the following into a PCR tube in the following order:

1. 29 uL water
2. 5 uL Expand 10x Buffer 2
3. 5 uL 10x dNTPs (2 mM in each; 0.2 mM final conc)
4. 5 uL Oligo 1 (100uM)
5. 5 uL Oligo 2 (100uM)
6. 0.75 uL Expand Polymerase 1

I put the resulting wobble PCR tube in the 2k55 ice bucket.

Zhen Z. Huang 15:05, 16 February 2010 (EST)

sbb31

1. PCR
2. Analytical gel
3. Regular Zymol Clean up
4. EcoR1/BamH1 Digest of PCR Product
5. Zymol Gel Purification
6. Ligation of EcoR1/BamH1 Digest
7. Mapping
8. Zymol Gel Purification

sbb15

1. Wobble
2. Small Zymol Clean up
3. EcoR1/BamH1 Digest of Wobble Product
4. Zymol Gel Purification
5. Ligation of EcoR1/BamH1 Digest
6. Mapping
7. Zymol Gel Purification

Construction Files for my parts

sbb31

sbb31: CA42 origin of replication
Source:  pEC22-CA42
Target Sequence:  agcacttcagcgcgccgtagcatcgataaacattacgggatggggcgaaactgccatctgttcgaaatgacgcgcaaatgggcttacagggcgattcgtcagggctggccagcattctcacagtggcttgatgccgtgattcagcgtgtcgaaatgtacaacgcatcgcttcccgttccgctttcacctcctgaatgtcgggctattggcaagagtattgcgaaatacacgcacaggaacttcacggcggaaactttcgcacagtatgtggctgatacgcacacgccagaaatacaggccaagagaggcaggaaaggtggcatcgctaaaggcgaagcctacgatgacaagcgtttcatggcgctatgtatgctggagaatggatattctcagaaagctattgcggcgatgttggaggtttctactcgaaccattcgaaactggaaaagcggaaaatagcctatatcagataacagcgcctttctggcgtttttttgagcagtaggtcttttgccg
Vector:  pBjk2741
Short description: oriCA42
Genbank reference: D30056.1 
Family:  Origin of Replication

PCR ZZH001 and ZZH002 on pEC22-CA42  (547 bp, EcoRI/BamHI)
Sub into pBjk2741-Bca1144             (EcoRI/BamHI, 2472+910, L)
Product is pBca9523-sbb31         {oriCA42}
----------------------------
ZZH001   Forward oligo for cloning of oriCA42   
ccataGAATTCatgAGATCTagcacttcagcgcgccgtag
ZZh002   Reverse oligo for cloning of oriCA42    
ctgatGGATCCcggcaaaagacctactgctc

sbb15

sbb15: phiC31 attB
Source:  Synthetic
Target Sequence:  tgacggtctcgaagccgcggtgcgggtgccagggcgtgcccttgggctccccgggcgcgtactccacctcacccatctggtcca
Vector:  pBjk2741
Short descriptions: phiC31 attB
Genbank reference: AB306970 (759…842) 
Family:  Phage att site

good 20 bp gtgccagggcgtgcccttgg

Wobble ZZH003/ZZH004            (115bp, EcoRI/BamHI)
Sub into pBjk2741-Bca1144         (EcoRI/BamHI, 2170+910, L)
Product is pBjk2741-sbb15     {phiC31 attB}
----
ZZH003   Forward construction of phiC31 attB basic part
ccataGAATTCatgAGATCTtgacggtctcgaagccgcggtgcgggtgccagggcgtgcccttgg
ZZH004   Reverse construction of phiC31 attB basic part
ctgatGGATCCtggaccagatgggtgaggtggagtacgcgcccggggagcccaagggcacgccctggcac