SBB10Ntbk-ZhenZongHuang
Zhen Z. Huang 15:00, 31 March 2010 (EST)
Assay Team 3: Origin of Stability and copy number
My group will be characterizing the colE2 origins of replication. One set of experiments is used to determine which combinations of rep protein and ori together confer stable plasmid regulation in cells. In a second set of assays, you will determine the effect of regulatory elements on the plasmids for controlling the copy number of the ori.
Assay 1:
Zhen Z. Huang 15:00, 1 March 2010 (EST)
Today, I did ligation and transformation for SBB15 and SBB 31.
I set up the following reaction for ligation
- 6.5uL ddH2O
- 1uL T4 DNA Ligase Buffer (small red or black-striped tubes)
- 1uL Vector(pBjk2741) digest
- 1uL Insert digest
- 0.5uL T4 DNA Ligase
- mix
- incubate on bench for 30 minutes
For transformation by heat shock Thaw a 200 uL aliquot of cells (JTK086 - double blue stripes)on ice
- Add 50 uL of water to the cells
- Add 30 uL of KCM to the cells
- Put your ligation mixture on ice, let cool a minute or two
- Add 70 uL of the cell cocktail to the ligation, stir to mix
- Let sit on ice for 10 min
- Heat shock for 90 seconds at 42 (longer incubation may work better)
- Put back on ice for 1 min
- Add 100uL of 2YT (same as LB), let shake in the 37 degree incubator for 1 hour
- Plate 70+ uL on selective antibiotics, let incubate at 37 degrees overnight
I put SSB15 Zymol 2 and SBB31 Zymol gel purification products in Box A.
Zhen Z. Huang 14:00, 24 February 2010 (EST)
EcoRI/BamHI Digest of PCR Products for SBB 31
EcoRI/BamHI Digest of Wobble Products for SBB 15 Did a small Zymol clean up for SBB 15. Product is put into Box A.
I incubate SBB 31 and 15 at 37 degrees on the thermocycler for 1hr. Started at 2:00.
Zhen Z. Huang 13:30, 22 February 2010 (EST)
I prepared analytical gel for sbb31.
It looks like about 500 bps. The expected product is 547 bp. This looks like the right product.
- Sbb31 -- Zymol Clean up
- Sbb15 -- Small Zymol Clean up
Because I forgot to label the tubes, I do not know which one is SBB15 and which one is SBB31. Need to run gel to figure out which one is which.
SBB31 and SSB15 are switched. gel results.
SBB31 and SBB15 are stored in Box B.
Zhen Z. Huang 16:05, 17 February 2010 (EST)
Wed, Feb 17th, 2010
I prepared a PCR reaction for sbb31 and a wobble reaction for sbb15.
sbb31
Regular PCR
I made The oligo concentrations of 100uM for ZHH001 and ZHH002 by adding the right amount of DDH20. Then I made oligo dilution of with 9uL Water and 1uL 100uM of the oligos to make 10uM.
I added the following into a PCR tube in the following order:
- 24uL ddH2O
- 3.3uL 10x Expand Buffer "2"
- 3.3uL dNTPs (2mM in each)
- 1uL Oligo 1, 10uM
- 1uL Oligo 2, 10uM
- 0.5uL Expand polymerase "1"
- 0.5uL Template DNA
I put the the PCR tube in the 2K55 ice bucket.
sbb15
Wobble
I made The oligo concentrations of 100uM for ZHH003 and ZHH004 by adding the right amount of DDH20
I added the following into a PCR tube in the following order:
- 29 uL water
- 5 uL Expand 10x Buffer 2
- 5 uL 10x dNTPs (2 mM in each; 0.2 mM final conc)
- 5 uL Oligo 1 (100uM)
- 5 uL Oligo 2 (100uM)
- 0.75 uL Expand Polymerase 1
I put the resulting wobble PCR tube in the 2k55 ice bucket.
Zhen Z. Huang 15:05, 16 February 2010 (EST)
Planning for Wed, Feb 17th, 2010
sbb31
- PCR
- Analytical gel
- Regular Zymol Clean up
- EcoR1/BamH1 Digest of PCR Product
- Zymol Gel Purification
- Ligation of EcoR1/BamH1 Digest
- Transformation
- Miniprep
- Mapping
- squencing
sbb15
- Wobble
- Small Zymol Clean up
- EcoR1/BamH1 Digest of Wobble Product
- Small Zymol Clean up
- Ligation of EcoR1/BamH1 Digest
- Transformation
- Miniprep
- Mapping
- squencing
Zhen Z. Huang 13:00, 18 February 2010 (EST)
Construction Files for my parts
sbb31
sbb31: CA42 origin of replication
Source: pEC22-CA42
Target Sequence: agcacttcagcgcgccgtagcatcgataaacattacgggatggggcgaaactgccatctgttcgaaatgacgcgcaaatgggcttacagggcgattcgtcagggctggccagcattctcacagtggcttgatgccgtgattcagcgtgtcgaaatgtacaacgcatcgcttcccgttccgctttcacctcctgaatgtcgggctattggcaagagtattgcgaaatacacgcacaggaacttcacggcggaaactttcgcacagtatgtggctgatacgcacacgccagaaatacaggccaagagaggcaggaaaggtggcatcgctaaaggcgaagcctacgatgacaagcgtttcatggcgctatgtatgctggagaatggatattctcagaaagctattgcggcgatgttggaggtttctactcgaaccattcgaaactggaaaagcggaaaatagcctatatcagataacagcgcctttctggcgtttttttgagcagtaggtcttttgccg
Vector: pBjk2741
Short description: oriCA42
Genbank reference: D30056.1
Family: Origin of Replication
PCR ZZH001 and ZZH002 on pEC22-CA42 (547 bp, EcoRI/BamHI)
Sub into pBjk2741-Bca1144 (EcoRI/BamHI, 2472+910, L)
Product is pBca9523-sbb31 {oriCA42}
----------------------------
ZZH001 Forward oligo for cloning of oriCA42
ccataGAATTCatgAGATCTagcacttcagcgcgccgtag
ZZh002 Reverse oligo for cloning of oriCA42
ctgatGGATCCcggcaaaagacctactgctc
sbb15
sbb15: phiC31 attB
Source: Synthetic
Target Sequence: tgacggtctcgaagccgcggtgcgggtgccagggcgtgcccttgggctccccgggcgcgtactccacctcacccatctggtcca
Vector: pBjk2741
Short descriptions: phiC31 attB
Genbank reference: AB306970 (759…842)
Family: Phage att site
good 20 bp gtgccagggcgtgcccttgg
Wobble ZZH003/ZZH004 (115bp, EcoRI/BamHI)
Sub into pBjk2741-Bca1144 (EcoRI/BamHI, 2170+910, L)
Product is pBjk2741-sbb15 {phiC31 attB}
----
ZZH003 Forward construction of phiC31 attB basic part
ccataGAATTCatgAGATCTtgacggtctcgaagccgcggtgcgggtgccagggcgtgcccttgg
ZZH004 Reverse construction of phiC31 attB basic part
ctgatGGATCCtggaccagatgggtgaggtggagtacgcgcccggggagcccaagggcacgccctggcac