Stanford/BIOE44:Module3:Day2:mercury
Novel Mercury Sensor
- Authors: Chris Brunson, Karina Padilla
Purpose
- To create a novel biosensor that senses inorganic mercury and generates a color as an indicator of the presence of mercury pollution in an aquatic environment.
Rationale
Environmental mercury is usually present as dissolved mercury in water, or as Hg2+ ions.
Long Description
The device is designed to express a color gene as a result of the presence of mercury in water. merR, from Thermus thermophilus HB27, expresses a promoter repressor protein that binds to the promoter region of the mer operon, repressing transcription. In the presence of mercury, the mercury ions bind to the repressor proteins which unbind from the promoter and as a result initiate transcription. In the device, a color generator will be placed downstream of the promoter and merR so that in the presence or mercury, transcription initiates and color is expressed.
The mer operon is in HB27 is composed of the promoter region, OAH/OAS sulfhydrylase, MerR, and Mercury Reductase. Sulfydrylase and Mercury Reductase are irrelevant for our design, but literature states that the promoter region is found 69 bp upstream the sulfhydrylase sequence. In searching for the promoter sequence, we isolated 200 bp upstream of the sulfhydrylase and used BCM Search Launcher to predict the location of the promoter.
Short Description
- The gene sequences of the promoter region and merR of the mer operon in T. thermophilus HB27 will be placed upstream of color generator gene. Color will be expressed in the presence of mercury.
Promoter Sequence(repressor protein binds)
- As predicted by BCM Search Launcher, the sequence of the promoter is:
- gaattcgcggccgcttctagagATGGTGATGAACTCCTGGGCCAGGCCCAGACCTGCGAGCGTCAAAGCGGCAAGGATCAGCTTCCTCATACACACCTCCTTGGTGCCGCCGGTAGTATACCCGGCCCTTGCCCTTCTGGCAAGCGCCGCGCGGCCCAGGGAGGGGTTTTTCGCTAGACTAGGGGG:TAtactagtagcggccgctgcag
Mercury Sensitive Transcriptional Regulator Protein Sequence (merR repressor protein ORF)
- gaattcgcggccgcttctagATGCCCTACACCATCGGCGAGCTCGCCCGGGCGTTTGGCCTTTCTCCTGATGCCCTCCGCTACTACGAAAGGCTTGGGCTCCTCGCCCCCAGCGGCCGTTCGCCCGGGGGGGTTCGCCTCTACGGGGAGGAGGCCTTCCGCCGCCTCCGCTTCATCAAGGAGGCCC:AGGCGGCGGGGCTTAAGCTTGAGGACATCGCCTGGATCCTCCGCGCCGTGGAGGAGGGCCATCCCCCCTGCCGCCACGTGCGGGAGGCCCTGGCCAAGCGCCTGGCGGAGGTGCGGCGTAGGCTCAGGGAGCTCCAGGCCCTGGAAGCGGCCCTGGCCGAACGGCTGGCCTACGCCGAGGCCCACC:CTGACCCTGCTTGCGACGGGCGGGACCGCTGCGTCTATTTGGACCCCCTTGACCCTGGAGCACGCTCCAGGGTCTAGTAAtactagtagcggccgctgcag
Sequence Refinement
There was no primary sequence refinement needed; no restriction enzyme sites were present in the initial sequence. However, the sequence had to be reverse complimented, as it is read the opposite way when transcribed. BioBrick prefix and suffix sequences were added to the ends of each sequence, and the ORF had a TAA added before the restriction enzyme sites.
References
- An initial characterization of the mercury resistance (mer) system of the thermophilic bacterium Thermus thermophilus HB27.
- Wang Y, Freedman Z, Lu-Irving P, Kaletsky R, Barkay T.
- FEMS Microbiol Ecol. 2009 Jan;67(1):118-29.
- Department of Biochemistry and Microbiology, Rutgers, The State University of New Jersey, New Brunswick, NJ, USA.
- The genome sequence of the extreme thermophile Thermus thermophilus.
- Nat Biotechnol. 2004 May;22(5):547-53. Epub 2004 Apr 4.
- Henne A, Brüggemann H, Raasch C, Wiezer A, Hartsch T, Liesegang H, Johann A, Lienard T, Gohl O, Martinez-Arias R, Jacobi C, Starkuviene V, Schlenczeck S, Dencker S, Huber R, Klenk HP, :Kramer W, Merkl R, Gottschalk G, Fritz HJ. Göttingen Genomics Laboratory, Institute of Microbiology and Genetics, University of Göttingen, Germany. ahenne@g2l.bio.uni-goettingen.de
Tools
ApE http://www.biology.utah.edu/jorgensen/wayned/ape/ BCM Search Launcher: Gene Feature Searches http://searchlauncher.bcm.tmc.edu/seq-search/gene-search.html
