IGEM:MIT/2006/Notebook/2006-7-24

From OpenWetWare
Revision as of 15:50, 24 July 2006 by Veenav (talk | contribs)
Jump to navigationJump to search

Smell Experiments w/ Isoamyl Acetate

  • Questions that we want to answer:
    1. Does IAA smell like banana? Yes
    2. Does IAA smell strongly in LB?
    3. At what IAA concentration can E. coli "normal" growth?
      • Culture Top10s and add different concentrations of IAA after cells reach OD ~ 0.5

osmY PCR

Done with each pair of new primers meant for PCRing both the short and long osmY promoter region.

  • 45μL PCR SuperMix
  • 2.5μL 0.55ng/μL E. coli genome
  • 1.25μL each respective primer (25 ng/μL)

Did we get transformants using the annealed primers? NO! :(

pchB and pchA primers

  • pchB forward: atgaaaactcccgaagactgcac