SBB12Ntbk-Tina Nie
--Tina Nie 14:25, 16 February 2012 (EST))
First day of labwork: Set up two PCR reactions. Set up wobble reaction for sbb1227:
Wobble tn001F/tn002R (64bp, wobpdt)
Digest wobpdt (NheI/BamHI, L, wobdig)
Digest pBca9525-Bca1834 (NheI/BamHI, L, vectdig)
Ligate wobdig and vectdig (pBca9525-sbb1227) {Leu8}
----------------------------------------------------------------------
>tn001F Forward construction of sbb1227 basic part
ccataGCTAGCggcagtggatctggtCTGCTACTGTTGCTG
>tn002R Reverse construction of sbb1227 basic part
CTGATggatccTTACAGGAGTAGCAGCAACAGTAGCAGaccag
>wobpdt
ccataGCTAGCggcagtggatctggtCTGCTACTGTTGCTGCTACTCCTGTAAggatccATCAG
Using protocol:
- 29 uL water
- 5 uL Expand 10x Buffer 2
- 5 uL 10x dNTPs (2 mM in each; 0.2 mM final conc)
- 5 uL Oligo 1 (100uM)
- 5 uL Oligo 2 (100uM)
- 0.75 uL Expand Polymerase 1
Set up PCA1 (assembly) reaction for sbb1213:
PCA1 on o15,o11,o12 (pca1) PCA2 with o15/o12 on pca1 (139 bp, pca2) Digest pca2 (NheI/BamHI, L, 1213dig) Digest pBca9525-Bca1834 (NheI/BamHI, L, vectdig) Ligate 1213dig + vectdig, product is pBca9525-sbb1213 ---- >o15 CCATAgctagcGGCAGTGGATCTGTTAAAGAAGCGGAAGACAAAAACGAAGAACTGCTGAGT >o11 CAAAAACGAAGAACTGCTGAGTGCCGCTTACCACGCAGCCAACGAAGTTGCTCGTCTGA >o12 CAGTAGGATCCTTAGCCGCCACGTTCGCCAACCAGTTTTTTCAGACGAGCAACTTCGTT >pca2 CCATAgctagcGGCAGTGGATCTGTTAAAGAAGCGGAAGACAAAAACGAAGAACTGCTGAGTGCCGCTTACCACGCAGCCAACGAAGTTGCTCGTCTGAAAAAACTGGTTGGCGAACGTGGCGGCTAAGGATCCTACTG
Using protocol:
- 38 uL ddH2O
- 5 ul 10x expand buffer
- 5 ul 2mM dNTPs
- 1 ul oligo mixture (100uM total, mixture of oligos after combination of 100uM stocks)
- 0.75 ul Expand polymerase
Both programs run for us after class.
Dilutions I made to make up 100uM solutions:
tn001F: 23.4nM + 234uL ddH2O
tn002R: 23.4nM + 234uL ddH2O
O15: 86.1nM + 861uL ddH2O
--Tina Nie 17:19, 17 February 2012 (EST)
Used Small Fragment Zymo Cleanup on both the wobble reaction product (for sbb1227) and the PCA1 product(for sbb1213), using the following protocol:
- Add 100 uL of Zymo ADB buffer (brown bottle) to the reaction.
- Transfer into the Zymo column (small clear guys)
- Add 500uL of Ethanol and pipette up and down to mix
- spin through (15s), discard waste.
- Add 200 uL of Zymo Wash Buffer (which is basically 70% ethanol)
- spin through (15s), discard waste.
- Add 200 uL of Zymo Wash Buffer
- spin through, discard waste.
- spin for 90 seconds, full speed to dry.
- elute with water (spin 60s) into a fresh Eppendorf tube
I used 50uL of ddH2O to elute.
After Small-frag Zymo I set up the PCA amplification reaction (PCA2), using the following protocol:
- 1 ul each outer oligo (10 uM)
- 1 ul purified pca product
- .5 ul phusion
- 10 ul 5x phusion buffer
- 5 ul 2mM dNTPs
- 32.5 ul H2O
The PCR program was run for us after class.
--Tina Nie 13:25, 21 February 2012 (EST)
I used Small-frag Zymo to purify the PCA2 product, following the protocol:
- Add 100 uL of Zymo ADB buffer (brown bottle) to the reaction.
- Transfer into the Zymo column (small clear guys)
- Add 500uL of Ethanol and pipette up and down to mix
- spin through (15s), discard waste.
- Add 200 uL of Zymo Wash Buffer (which is basically 70% ethanol)
- spin through (15s), discard waste.
- Add 200 uL of Zymo Wash Buffer
- spin through, discard waste.
- spin for 90 seconds, full speed to dry.
- elute with water (spin 60s) into a fresh Eppendorf tube
using 51uL of ddH2O to elute.
After the Zymo clean up I ran the product on an analytic gel to check I had the right product.
I used 6uL of the purified DNA and 4uL of loading dye in the gel.
In my column there was a very faint band at about 100 bases (by comparison with the DNA ladder). It may be consistent with the PCA2 product which should be 139bp but it is difficult to tell.
I set up the digestion reaction for sbb1227 (Leu8) using the following protocol:
50uL eluted DNA 5.7uL NEB Buffer 2 0.5uL NheI 0.5uL BamHI
I incubated this for 1 hour at 37 degrees.
I also set up the digestion for sbb1213 (lz_AAAA-2) using the following:
8uL of eluted PCR product 1uL of NEB Buffer 2 0.5uL NheI 0.5uL BamHI
and incubated at 37 degrees for 1 hour.
After the incubation time I added 100 uL of Zymo ADB buffer to each reaction (first step of small-frag Zymo clean-up) to kill the enzymes. I will finish the Zymo clean-up next lab class.
--Tina Nie 13:40, 23 February 2012 (EST)
I finished the small-frag Zymo cleanup for both parts following the protocol:
- Transfer into the Zymo column (small clear guys)
- Add 500uL of Ethanol and pipette up and down to mix
- spin through (15s), discard waste.
- Add 200 uL of Zymo Wash Buffer (which is basically 70% ethanol)
- spin through (15s), discard waste.
- Add 200 uL of Zymo Wash Buffer
- spin through, discard waste.
- spin for 90 seconds, full speed to dry.
- elute with water (spin 60s) into a fresh Eppendorf tube
I used 56.7uL of ddH2O to elute the sbb1227 digestion product, and 10uL of ddH2O to elute the sbb1213 digestion product.
I then set up both ligations using the following:
6.5uL ddH2O 1uL T4 DNA Ligase Buffer (small red or black-striped tubes) 1uL Vector digest (pBca9525-Bca1834 NdeI/BamHI, this was already digested for us) 1uL Insert digest 0.5uL T4 DNA Ligase
- Pound upside down on the bench to mix
- Give it a quick spin to send it back to the bottom of the tube
- Incubate on the benchtop for 30min
- Put on ice and proceed to the transformation
I used the follwoing protocol for the transformations:
1. Thaw a 200 uL aliquot of cells on ice 2. Add 50 uL of water to the cells (if greater volume is desired) 3. Add 30 uL of KCM to the cells 4. Put your ligation mixture on ice, let cool a minute or two (for Miniprep product, dilute by 10, then use 1uL of dilution) 5. Add 70 uL of the cell cocktail to the ligation, stir to mix 6. Let sit on ice for 10 min 7. Heat shock for 90 seconds at 42 (longer incubation may work better) 8. Put back on ice for 1 min 9. Add 100uL of 2YT, let shake in the 37 degree incubator for 1 hour 10. Plate 70+ uL on selective antibiotics, let incubate at 37 degrees overnight
However there was less cells in each aliquot than the 200uL expect (it was more like 100 uL) so we added only 15uL of KCM and used 50uL of cells in each transformations.
--Tina Nie 18:08, 24 February 2012 (EST)
From each plate I picked 4 colonies, using the following:
- Add 4mL of LB media with the appropriate antibiotics to a clean test tube (this was done for us)
- Pick a well-isolated, round, and "normal" looking colony with a toothpick
- Drop it in the test tube
- Incubate at 37 overnight
Except that I used a p10 pipette tip insead of a toothpick to pick the colonies.
--Tina Nie 14:23, 28 February 2012 (EST)
After looking at the plates today some of the colonies had turned red while some were white. I had picked half white and half red colonies last time however none of the white colonies grew in the media. So today I redid the ligation and transformation for both parts.
Ligation:
6.5uL ddH2O 1uL T4 DNA Ligase Buffer (black-striped tubes) 1uL Vector digest (pBca9525-Bca1834 NheI/BamHI) 1uL Insert digest 0.5uL T4 DNA Ligase
- Pound upside down on the bench to mix
- Give it a quick spin to send it back to the bottom of the tube
- Incubate on the benchtop for 30min
- Put on ice and proceed to the transformation
Transformation by heat shock:
1. Thaw a 100 uL aliquot of cells on ice 2. Add 30 uL of KCM to the cells 3. Put your ligation mixture on ice, let cool a minute or two 4. Add 70 uL of the cell cocktail to the ligation, stir to mix 5. Let sit on ice for 10 min 6. Heat shock for 90 seconds at 42 (longer incubation may work better) 7. Put back on ice for 1 min 8. Add 100uL of 2YT, let shake in the 37 degree incubator for 1 hour 9. Plate 70+ uL on selective antibiotics, let incubate at 37 degrees overnight
--Tina Nie 14:32, 1 March 2012 (EST)
Zach has already picked 2 colonies from each plate I made last lab class. Today I miniprep purified the DNA for each part and decided which enymes to use in the analytical digests next class.
Miniprep Purification:
(using the QIAGEN QIAPrep Spin Miniprep kit)
!!!!! Make sure Ethanol has been added to the PE Buffer !!!!!
!!!!! Make sure that RNAse has been added to the P1 Buffer !!!!!
- Pellet 2 mL saturated culture by spinning full speed, 30 seconds in a 2mL Microcentrifuge tube.
- Dump supernatant
- Add 250uL of P1 buffer into each tube. Resuspend the cells thoroughly
- Add 250uL of P2 buffer (a base that denatures everything and causes cells to lyse). Gently mix up and down. Solution should become clearer.
- Add 350uL of N3 buffer (an acid of pH ~5 that causes cell junk - including protein and chromosomal DNA - to precipitate, and leaves plasmids and other small molecules in solution). Slowly invert a few times, then shake.
- Spin in centrifuge at top speed for 5 minutes.
- Label blue columns with an alcohol-resistant lab pen.
- Pour liquid into columns, and place the columns into the centrifuge. Spin at full speed for 15 seconds.
- Dump liquid out of the collectors under the columns (the DNA should be stuck to the white resin)
- Wash each column with 500 uL of PB buffer.
- Spin in centrifuge at full speed for 15 seconds, then flick out the liquid again.
- Wash with 750uL of PE buffer (washes the salts off the resins).
- Spin in centrifuge at full speed for 15 seconds and flick out liquid again.
- Spin in centrifuge at full speed for 90 sec to dry off all water and ethanol.
- Label new Microcentrifuge tubes and put columns in them.
- Elute them by adding 50uL of water down the middle of the column (don't let it stick to the sides).
- Spin in centrifuge at top speed for 30 seconds.
- Take out columns and cap the tubes.
The enzymes I will be using for the analytical gel (mapping) are:
for sbb1227: EcoRI/BamHI
for sbb1213: NheI/BamHI
I chose these based on how distinguishable the bands of these digests are between the original vector (pBca9525-Bca1834) and the predicited product.
--Tina Nie 15:40, 2 March 2012 (EST)
Today I ran an analytical digest of the 4 mimiprepped products using the following protocol:
Set up the following 10uL reaction in a PCR tube:
4uL ddH2O 4uL Miniprepped plasmid 1uL 10x NEB Buffer 2 .5uL of each of the two enzymes
- Incubate at 37 on the thermocycler for 30 minutes
For part sbb1227 I used EcoRI and BamHI.
For part sbb1213 I used NheI and BamHI.