SBB12Ntbk-Robert D O'Dowd

From OpenWetWare
Jump to navigationJump to search

~~!~~

Partname:     sbb1231
Featurename:  cI-TM
Genename:     cI, other
Source:       Lambda phage / other

This one is a little different. You aren't putting a homodimer onto ToxR; you're building out a different homodimerization system. In this experiment, you are trying to reproduce some experiments based on PMID 9671551. In their study, they append different dimerizing transmembrane (TM) segments to the lambda repressor DNA binding domain fragment (cI') and see whether CI's activity is restored. In one case, they discuss making fusion proteins such as:

 Nterm-cI'-linker-TM-PhoA-Cterm

That would be a nice construct to have because you can do 2 assays with it: transcriptional repression from cI-dependent promoters, and periplasmic targetting with alkaline phosphatase.

Your design of this part depends on your reading of the paper and the availability of materials from which you could construct the things they describe. You'll probably want to discuss the design of your part with JCA after you have read and made sense of the paper. Your final construct should be a normal BglBricks part in plasmid pBca9525. You most likely will want to piece the part together from two (or more) pcr products. The cI construct can be amplified from pBca9145-jtk2768. You can get PhoA from plasmid pBjh1601CK-Bjh2128.

Construction File

PCR ca998/rdoSOECI_TM-R  on pBca9145-jtk2768	        (cifrag, 583bp)
PCR rdoSOETM_PhoA-F/g00101 on pBjh1601CK-Bjh2128	(phofrag, 1327bp)
PCR ca998/g00101 on cifrag+phofrag                      (pcrpdt_sbb1231, 1890bp)
Digest pBca9525-Bca1834				        (EcoRI/BamHI, L, vectdig)
Digest pcrpdt_sbb1231				        (EcoRI/BamHI, L, pcrdig)
Ligate pcrdig and vectdig, product is pBca9525-sbb1231
----
>rdoSOECI_TM-R   Combining CI'head and MalF TM
CCAACCAGCAGACCCAGCAGACCCAGAACAGACCATTTACGTTTAGATCCgcttacccatctctccgcatc
>rdoSOETM_PhoA-F  Combining MalF TM with PhoA
CTGCTGGGTCTGCTGGTTGGTTACCTGGTTGTTCTGATGTACGGATCTtctagaATTGATGCCCTGCCGCTGAC
>pcrpdt
GTATCACGAGGCAGAATTTCAGATAAAAAAAATCCTTAGCTTTCGCTAAGGATGATTTCTGGAATTCATGAGATCTGTTAATGCTAGCTCAGTCCTAGGGACTCTGCTAGCGGATCTAGACATAAAAACGGCAAAGTATGAGCACAAAAAAGAAACCATTAACACAAGAGCAGCTTGAGGACGCACGTCGCCTTAAAGCAATTTATGAAAAAAAGAAAAATGAACTTGGCTTATCCCAGGAATCTGTCGCAGACAAGATGGGGATGGGGCAGTCAGGCGTTGGTGCTTTATTTAATGGCATCAATGCATTAAATGCTTATAACGCCGCATTGCTTGCAAAAATTCTCAAAGTTAGCGTTGAAGAATTTAGCCCTTCAATCGCCAGAGAAATCTACGAGATGTATGAAGCGGTTAGTATGCAGCCGTCACTTAGAAGTGAGTATGAGTACCCTGTTTTTTCTCATGTTCAGGCAGGGATGTTCTCACCTGAGCTTAGAACCTTTACCAAAGGTGATGCGGAGAGATGGGTAAGCGGATCTAAACGTAAATGGTCTGTTCTGGGTCTGCTGGGTCTGCTGGTTGGTTACCTGGTTGTTCTGATGTACGGATCTTCTAGAATTGATGCCCTGCCGCTGACCGGACAATATACCCACTATGCGCTGAATAAAAAAACCGGCAAACCAGATTACGTGACCGATTCCGCCGCCTCAGCCACCGCGTGGTCCACAGGGGTGAAAACCTACAACGGCGCGCTGGGGGTCGATATTCATGAAAAAGATCATCTGACCATTCTCGAAATGGCGAAGGCCGCAGGTCTGGCTACCGGCAACGTCTCGACCGCGGAGTTGCAGGACGCCACCCCGGCAGCGCTGATTGCCCATGTCACCTCGCGCAAATGCTATGGCCCGACGGCGACCAGCGAAAAATGTCCGACAAACGCGCTGGAAAAGGGCGGCAAAGGCTCGATTACTGAACAGCTCCTGAACGCGCGGGCGGACGTCACCCTGGGCGGCGGCGCGAAAACCTTCGCCGAGACGGCAACCGCCGGCGAGTGGCAGGGGAAAACGCTGCGTGAGCAGGCGCAGATGCGCGGCTACCAGTTAGTCGGCGATGCCGCCTCTTTAGCGGCGATCGACGAAGCGAATCAGGACAAACCGCTGCTGGGACTGTTCGCAGAGGGGAATATGCCGGTGCGCTGGGAAGGGCCGAAGGCCTCGTACCACGGCAATATTGATAAACCTGCCGTGACCTGTACGCCAAATCCGAAACGCAATGACGCGATTCCCACGCTGGCGCAGATGACCGACAAAGCCATCGAACTGTTGAGCAAAAATGAGCGGGGCTTCTTTTTACAGGTGGAAGGCGCGTCTATCGATAAGCAGGATCACGCCGCGAACCCGTGCGGACAGATTGGCGAGACGGTGGATCTTGATGAAGCCGTACAGAGGGCGCTGGCCTTTGCGAAGAAAGACGGCAATACGCTGGTGATCGTTACCGCCGATCATGCTCATGCCAGCCAGATCGTGGCGCCCGAAACGAAAGCGCCGGGGCTGACGCAGGCGCTGAACACCAAAGATGGCGCGGTGATGGTCATCAGCTACGGCAACTCGGAAGAAGATTCCCAGGAGCATACCGGCAGCCAGCTGCGCATCGCCGCTTACGGGCCGCATGCGGCGAACGTGGTCGGGCTGACCGATCAAACCGATCTGTTCTACACCATGAAAGCGGCGCTGGGCCTGAAGTAATGGATCTAAAAAAAAACCCCGCCCCTGACAGGGCGGGGTTTTTTTTAGGATCCTAACTCGACGTGCAGGCTTCCTCGCTCACTGACTCGCTGCGCTCGGTCGTTCGGCTGCGGCGAGCGGTATCAGCTCACTCAAAGGCGGTAAT


Partname:     sbb1214
Featurename:  lz_AAAA-3
Genename:     leucine zipper variant
Source:       Synthetic, see PMID:12459719 

This part encodes a leucine zipper

We will be using a set of leucine zippers as homodimer domains. In total, we'll have 8 of them all with different Kd's for homodimerization. However, the sequences only differ at the same 4 amino acid sites. This will allow us to test whether the activation of ToxR is dependent on the Kd of the homodimer that is attached to it. These sequences are entirely synthetic, but all should encode the following peptide:

VKELEDKNEELLS XX YH XX NEVARLKKLVGERGGC*

Where the x's are the amino acids I tell you. So, if I gave you the lz_IILK zipper to make, the peptide you should encode is: VKELEDKNEELLSIIYHLKNEVARLKKLVGERGGC*

Here is an example of what your trying to make pBca9525-sbb1230.

This part encodes a homodimer domain

You are going to put the homodimer on the C-terminus of a truncated ToxR. For this part, you're going to go off BioBricks. Kindov. Your final product will be a BioBrick, but you are going to use an ad hoc procedure to create it. You should examine this illustration which refers to two sequences: pBca9525-Bca1834 and pBca9525-Bca1839. The important thing here is that you think through the translation frame of the final product, and make sure that you add some linker between your sequence and the sequence 5' to it. You should also remove the start methionine from you homodimer, unless your project description explicitly says not to. You should include the stop codon.

The product of your construction file should resemble pBca9525-Bca1839 in terms of it encoding a full expression cassette containing a ToxR fusion protein with your designed feature. If you were given part sbb1293, your product would be called pBca9525-sbb1293.


Construction File

PCA1 on o16,o17,o12       (pca1)
PCA2 with o16/o12 on pca1 (139 bp, pca2)
Digest pca2               (NheI/BamHI, L, 1214dig)
Digest pBca9525-Bca1834   (NheI/BamHI, L, vectdig)
Ligate 1214dig + vectdig, product is pBca9525-sbb1214
----
>o16	
CCATAgctagcGGCAGTGGATCTGTTAAAGAAGCGGAAGACAAAGCAGAAGAAGCGCTGAGT
>o17
CAAAGCAGAAGAAGCGCTGAGTATCATCTACCACCTGAAAAACGAAGTTGCTCGTCTGA
>o12
CAGTAGGATCCTTAGCCGCCACGTTCGCCAACCAGTTTTTTCAGACGAGCAACTTCGTT
>pca2
CCATAgctagcGGCAGTGGATCTGTTAAAGAAGCGGAAGACAAAGCAGAAGAAGCGCTGAGTATCATCTACCACCTGAAAAACGAAGTTGCTCGTCTGAAAAAACTGGTTGGCGAACGTGGCGGCTAAGGATCCTACTG


sbb1214

PCA on o16, o17, o12. Followed PCA protocol[1]

Created 100uM dilutions of o16 o17 o12.

Add nm weight x10= uL of ddH2O.

Label tube 1214. Place on PCA rack.

sbb1231

PCR on ca998/rdoSOECI_TM-R and pBca 9145-jtk2768 Label CI TM 1231

PCR on rdoSOETM_PhoA-F/g00101 and pBjh 1601CK-Bjh2128 Label TM PhoA 1231

Followed PCR protocol [2]

Place CI TM 1231 on 500-1K bp rack

Place Label TM PhoA 1231 on 1K-2K bp rack

sbb1214

Zymo cleanup-small fragment cleanup. [3] Label 1214 PCA1

Amplification/phusion step. Template DNA added last. [4]

Template material and fragments for SOE placed in Eluded Products box.

Could not conduct SOEPCR gel or setup. Doing next tuesday.

sbb1231

Did not run any experiments

sbb1231

Prep 6 uL product w/ 4 uL loading buffer Placed on wells 9, 10 labeled ROTP and ROCT

Picture taken of gel->does not look correct

Lane 9 has W shaped smear

I do not believe my recordings. Either I switched what lanes I believed was which or one of my products failed. I will switch assumptions and assum 9 ROCT and 10 ROTP

Cut out band which correspond to correct size.

Cut out extra band. 1K band maybe from lane 9 is ROCT

Possible that 1K hidden in smear is actual TP product

No 500 band appeared in lane 10 so its doubtful.

Zymo gel purification

label 1231ROTP, 1231ROCT, 1231MaybeTP


Lanes:

1 2 3 4 5 6 7 8 9 10
Au PCA2 TN sbb1213 DC A DC B 2-log ladder JS MM JW RO TP RO CT

sbb1214

Cloning step. skip reassembly Named 1214 Cloning

Followed digestion of wobble product protocol [5] except digested with NheI/BamHI

Place in incubator at 1120

Store 1214 Cloning

sbb1231

SOE PCR Round 3

PCR 1231ROCT + 1231ROTP with ca998/g00101

Result labeled 1231PCR3

Placed in PCR rack for 1K-2K

sbb1214

Taking digested product from tuesday->zymo column [6]

Too much liquid for 1 column. Performing 2 rounds.

Added 50 uL H2O. This amount was not correct should have only eluded w/8uL. Possible that product is too diluted for later steps to work.

Ligate products

Incubate on benchtop for 30 min 11:12-11:42

Waiting until Friday for transformation

If there is an issue, it will likely be due to 6x dilution of vector

Can restart at 1214Cloning

sbb1231

Run gel for PCR product

Gel1 Lane 10 Labeled ROSOE3 1231

Place 1231 PCR3 back into box of products


Lanes:

1 2 3 4 5 6 7 8 9 10
MH PCRPDT 1218 MH PCRDIG 1218 empty DC SB 1221 Ladder empty empty empty GF PCA RO SOE3 1231


Cut out band at 2K place in tube labeled 1231SOE3 600uL ADB.

Melt and place on ice

2 bands show up. one considerably brighter and heavier, Selected smaller band because it looks closer to the target 1800 bp I expect.

sbb1214

Need to redo ligation

Incubating on benchtop for 30 min 12:30-1:00

Label product 1213lig

place on ice after 30 min

mix 30 uL KCM

Transfer 70 uL cell mixture to ligation tube. Wait 10 min 117-127

Probably dont have enough time to finish plating

Toss materials and retry tuesday

sbb1231

Complete zymo cleanup from product on Friday

Label purified product 1231SOEPur

Set up digestion from 1231SOEPur. Label 1231 dig. place at 37 at 1040-1140

Set up gel. 1202-1232

I expect to see a band at 1890


Lanes:

1 2 3 4 5 6 7 8 9 10
empty AJ A+B pcrpdt empty RD 1231 dig empty 2-log ladder empty empty empty empty


Dont see anything. Need to redo PCRs

sbb1214

Redo ligation for sbb1214

Label 1214 Lig. 1028-1058 bench top incubate.

Thaw cells and label cell prep. add 50 uL H2O.

Transfer to new tube labeled 1214 Trans. Place on ice 1111-1121

Heatshok at 42C for 90 sec

Place in shaker 1127-1227

Cutting incubatinon time by 15 min in order to complete during class period. 1212

Cells plated on Spec plates using alcohol sterilized wand.

Plate labeled 2/28 RDO1214 pBca1825_1214

Plate given to Zach

sbb1231

Run gel on PCR products CI_TM and TM_PhoA and make sure bands show up

Redo SOEPCR

Run gel. Lane 8 TMPhoA Lane 9 CITM


Lanes:

1 2 3 4 5 6 7 8 9 10
Karin 1206 1224(1) 1224(2) 1224(3) 1203(1) ladder AJ RO TM PhoI RO CITM Bad Load


Did not turn out well. Need to redo PCR

sbb1214

One sample vial of cultured cells found 1214-1. Apparently only 1 colony was picked.

Followed DNA Miniprep procedure. [7] Label all tubes used in process 1213_1RO

Final product labeled 1213-1RO mPrep

Need to run an analytical gel next time

sbb1231

Because final expected product did not show up in gel last time, I need to start over. Reconstructing CITM and TM PhoA.

PCR ca998/RDOSOECITM_R on pBca9145jtk2768. Mixture placed on 500-1k Rack

PCR RdoSOETMPhoA_F/g00101 on pBjh1601CK Bjh2128. Mixture placed on 1k-2k rack

sbb1214

Since it is recommended to have 2 clones and I only 1 colony was picked, I should run another transformation in order to get more clones

Digest pBca9525 Bca 1834 Nhe1 BamH1 and ligate with 1214dig

Not enough time to transform and plate cells.

Running an analytical gel with EcoRI XholI. Digest placed in incubator 103-133


Lanes:

1 2 3 4 5 6 7 8 9 10
AJ A+B AJ A+B MM 1232-1 MM 1232-2 MM 1215-2 RO MP 1214 Ladder MDP2 MDP1 MDL2

sbb1231

Need to run gel to retrieve and purify SOEPCR products

Lanes 1 (CITM) and 2 (TMPhoA) on Gel 3


Perform Zymo gel purification

1231 CITM2 and 1231 TMPhoA2 stored

Solution labeled 1231 SOE3. Placed on 1-2K rack

sbb1214

Looking back on my notes, I did not run the second round of PCA w/ o16 and o12 on pca1.

Restarting

PCA1 with o12, o16, o17

Note from 3/15

My results from the analytical gel would seem to indicate that I had performed the correct reactions even though I did not record them in my notebook. I continue with the restart anyways.


sbb1231

1231 SOE3 digested with EcoRI and BamHI. Solution labeled 1231 Dig

Placed in thermocycler 1007-1107

There is not enough time to ligate and plate.

Next week plan:

Digest 1h -> Gel 30m -> Zymo 15m -> Ligate 30m -> Transform 1h -> Plate 15m

sbb1214

Set up amplification for Pca1 mixture

Label 1214Pca1 amp and place on Pca2 Rack for next stage

Next week plan:

Zymo -> Digestion -> Ligation -> Transform -> Plating

Can run steps in parallel with 1231 at the ligation stage

sbb1231

1231 SOE3 digested with EcoRI and BamHI to get 1231 Dig

Placed in thermocycler from 1022-1122

Run gel. Lane 2 (RO 1231 dig)

Save image

Cut out the bright band in Lane 2

Add 600 mL ADB buffer and store for next time

sbb1214

1214Pca1 amp purified using zymo small fragment procedure.

Labeled 1214 pur

Begin digestion with NheI and BamHI. Result is 1214 dig.

Placed in thermocycler 1022-1122

1214 dig run on gel. Lane 1 (RO 1214 dig)

Add 600 mL ADB and store for next time



Lanes:

1 2 3 4 5 6 7 8 9 10
RO 1214 Dig RO 1231 Dig AJ A+B PCR digest **** Lader KA KA KA KA ladder

sbb1231

Zymo gel cleanup on RO 1231 Dig

Run ligation reaction.

pBca9525-Bca1834 digested with BamHI and EcoRI and ligated with RO 1231 Dig. Product is RO 1231 Lig

Place on bench for 30 min 1031-1101

Add KCM to competent cells. Place on Ice for 10 min 1110-1120

Transform cells with RO 1231 Lig in thermomcycler at 42 C for 90 seconds.

Place on ice for 1 min

Place in incubator for 1 hour 1126-1226


Spilled my transformed cells and lost about half. This may cause contamination or not enough cells being plated


Plate on Spec plates and label RDO 1231 3/15


sbb1214

Add 250 mL isopropanol. Proceed with Zymo small frag gel cleanup. Label resulting solution RO 1214 Dig

Digest pBca9525-Bca1834 with NheI and BamHI. Ligate this with RO 1214 Dig. Result is RO 1214 Lig

Incubate on bench for 30 in. 1031-1101.

Add cells to ligation. Let it sit on ice 10 min 1110-1120

Place in thermocycler at 42 C for 90 seconds

Place back on ice for 1 min

Place in incubator for 1 hour. 1126-1226

Plate cells on Spec plates and label them RDO 1214 3/15


sbb1231

4 Colonies were picked by Zach.

Turns out none of the cell cultures were viable and the plates I created were totally unusable. There are 2 large red clusters where cells survived. The colonies that were picked were likely contamination from when I leaked. It is also possible that the transformation totally failed.

Experiment stopped. sbb1231 inconclusive.

sbb1214

4 colonies picked. All 4 cultures are viable.

Performing miniprep on all 4. [8]

Resulting solutions were labeled RO 1214 1, RO 1214 2, RO 1214 3, RO 1214 4

Running analytical digests on miniprepped plasmids

RO 1214 1 and 2

Digest with XbaI and NheI

Expect bands at 3161 and 456 if successful and 3161 and 1174 if unsuccessful

RO 1214 3 and 4

Digest with BamHI and EcoRI

Expect bands at 2472 and 1145 if successful and 2472 and 1863 if unsuccessful

Not enough time to incubate and run the gel.

Performing the gel on Thursday.

Removing 1231ROCT, 1231PCR3, 1231CITM, 1214Pca1, 1231TMPhoA from storage in order to make space.

sbb1231

Not enough time to complete the experiment. I can redo the transformation and plating to at least figure out if my products were viable. If white colonies appear the Friday on a plate, I can say that the transformation at least happened.

Rerun ligation 1031-1101. pBca9525-Bca1834 digested with BamHI and EcoRI and ligated with RO 1231 Dig. Product is RO 1231 Lig2.

Competent cells thawed and prepared. Mixed with RO 1231 Lig2. Product is 1231 trans. Placed on ice for 10 min. 1113-1123

Incubate 1127-1127.

Cutting incubation 7 minutes early due to time.

Cells plated on Spec plates. Labeled RDO1231 3/22 No need to pick


sbb1214

Mapping miniprep

Thermocycler 30 min 1016-1046

Not sure if 1 and 2 will work. The XbaI enzyme solution is almost empty and less than .5 uL was added.

Run gel on lanes 1,2,3,4.


Lanes:

1 2 3 4 5 6 7 8 9 10
none RO 1214 1 RO 1214 2 RO 1214 3 RO 1214 4 2-log AJ digest DC A+B JW A10 none


All samples result in bands in the expected locations. Submitting 1214 2 and 1214 4 for sequencing.