IGEM:Paris Bettencourt 2012/Notebooks/RE group/Construction design
From OpenWetWare
Fse gene (gBlocks Gene Fragments)
- Gene sequence
- Check usage in E.Coli
- Check the lack of:
- EcoRI [E]
- Xbal [X]
- SpeI [S]
- PstI [P]
- FseI
- Codon optomozation
- ATG...TAA
- Salis Lab Calculator (not the strongest RBS)
We are planing FokI restriction site to devide sequence (almost in the middle).
RBS_FseI gBlocks construct
Complete Construct

Fragments 1
File:RBS FseI frag1.pdf Media:RBS_FseI_frg1.geneious
Fragements 2
RBS_IsceI gBlocks construct
Complete Construct
Fragments 1
Fragements 2
Sequences
Prefix 1
Before sequences starting with ATG
GAATTCGCGGCCGCTTCTAG
Prefix 2
Before sequences starting with no ATG
GAATTCGCGGCCGCTTCTAGAG
Suffix
TACTAGTAGCGGCCGCTGCAG
Plasmid 1 : pSB3C5_Pbad_RBS_FseI
- pbad : BBa_I13453
- RBS : BBa_B0032
- FseI: [1]
We used gBlocks to synthetize RBS_FseI
Geneious file : Media:Plasmid_Pbad_RBS_FseI.geneious (right click)
Plasmid 2 : pSB3C5_Pbad_RBS_IsceI
- pbad : BBa_I13453
- RBS : BBa_B0032
- IsceI:
We used gBlocks to synthetize RBS_IsceI
Geneious file : Media:Plasmid_Pbad_RBS_IsceI.geneious (right click)
Plasmid 3 : pSB3C5_Plac_RBS_FseI
We used gBlocks to synthetize RBS_FseI
Geneious file : Media:Plasmid_Plac_RBS_FseI.geneious (right click)
Plasmid 4 : pSB3C5_Plac_RBS_IsceI
We used gBlocks to synthetize RBS_IsceI
Geneious file : Media:Plasmid_Plac_RBS_IsceI.geneious (right click)