Biomod/2012/TU Dresden/Nanosaurs/Project/Aptamer lock
<html> <script src="http://biomod-dresden-2012.googlecode.com/svn/trunk/js/jquery-1.8.2.min.js"></script> <script src="http://biomod-dresden-2012.googlecode.com/svn/trunk/js/jquery-ui-1.9.1.custom.min.js"></script> <script src="http://biomod-dresden-2012.googlecode.com/svn/trunk/js/jquery.smooth-scroll.min.js"></script> <script src="http://biomod-dresden-2012.googlecode.com/svn/trunk/js/lightbox.js"></script> <script type="text/javascript" src="http://biomod-dresden-2012.googlecode.com/svn/trunk/js/jquery.queryloader2.js"></script> <script type="text/javascript" src="http://biomod-dresden-2012.googlecode.com/svn/trunk/js/superfish.js"></script> <script type="text/javascript" src="http://biomod-dresden-2012.googlecode.com/svn/trunk/js/jquery.hoverIntent.minified.js"></script> <script type="text/javascript" src="http://biomod-dresden-2012.googlecode.com/svn/trunk/js/jquery.scrollTo-1.4.3.1-min.js"></script> <script type="text/javascript" src="http://biomod-dresden-2012.googlecode.com/svn/trunk/js/jquery.localscroll-1.2.7-min.js"></script> <link href='http://fonts.googleapis.com/css?family=Merriweather:400,700' rel='stylesheet' type='text/css'> <link href='http://biomod-dresden-2012.googlecode.com/svn/trunk/css/superfish.css' rel='stylesheet' type='text/css'> <link rel="stylesheet" href="http://biomod-dresden-2012.googlecode.com/svn/trunk/css/lightbox.css" type="text/css" media="screen" /> <link rel="stylesheet" href="http://code.jquery.com/ui/1.9.0/themes/base/jquery-ui.css" /> <script type"text/javascript"> // Main function that waits for the browser to be ready $(document).ready(function(){ //make css accesible, please change the alter_css to chnage the style var alter_css = $("#alter_css").html(); $("style").remove(); $('head').append('<link rel="stylesheet" href="/skins/monobook/shared.css?164" type="text/css" />'); $('head').append('<link rel="stylesheet" href="http://biomod-dresden-2012.googlecode.com/svn/trunk/nanos.css" type="text/css" />'); //additional divs
$(".firstHeading").wrap('
'); $(".firstHeading").wrap('
'); $(".firstHeading").wrap('
');
var nav = $("#nav").html(); $('#inner_header').append(nav);
$('#inner_header').append('
');
//clean up wiki framework $("#sidebar-main").remove(); $(".portlet").remove(); //fix breadcrumbs $('#contentSub').remove(); //fix heading var h1 = $(".firstHeading").text().split("/"); $(".firstHeading").text(h1[h1.length-1]); //start plugins for navigation $("ul.sf-menu").superfish({ delay: 800, // one second delay on mouseout animation: {opacity:'show',height:'show'}, // fade-in and slide-down animation speed: 'normal', // faster animation speed }); $('#main_saurs').localScroll(); $("tr:odd").addClass("odd");
}); </script>
<script type="text/javascript"> var _gaq = _gaq || []; _gaq.push(['_setAccount', 'UA-35720700-1']); _gaq.push(['_trackPageview']);
(function() { var ga = document.createElement('script'); ga.type = 'text/javascript'; ga.async = true; ga.src = ('https:' == document.location.protocol ? 'https://ssl' : 'http://www') + '.google-analytics.com/ga.js'; var s = document.getElementsByTagName('script')[0]; s.parentNode.insertBefore(ga, s); })(); </script> <script type="text/javascript">var addthis_config = {"data_track_addressbar":false};</script> <script type="text/javascript" src="http://s7.addthis.com/js/300/addthis_widget.js#pubid=ra-508414b242f27ceb"></script> <script id="nav">
</script>
</html>
<html> <script> $(function() { $( "#tabs" ).tabs(); }); </script>
<body>
- <a href="#tabs-1">Lock and Key</a>
- <a href="#tabs-2">Experimental Methods </a>
- <a href="#tabs-3">Challenges Faced</a>
The Search for Locks and Keys
After designing our DNA origami box, we started looking for a suitable "lock and key" system. With a suitable lock and key, we would be able to open a closed origami box, as shown in Fig. 1.
<a rel="lightbox[aptamer_origami]" title="Front view of a closed origami box" href="http://openwetware.org/images/2/27/BM12_Nanosaurs_DNA_Origami_Closed_Aptamer_800.jpg"><img src="http://openwetware.org/images/1/17/BM12_Nanosaurs_DNA_Origami_Closed_Aptamer_250.jpg"></a>
Fig. 1 When the lock and key interact, the origami box opens.
For our purposes, we adapted the lock and key system based on the specific binding of PDGF (Platelet Derived Growth Factor) to an aptamer strand. Such a system has been successfully used for a similar application (Douglas et al., Science 17 Feb 2012, Vol 335: 831-834). Aptamers are artificial specific oligonucleotides, DNA or RNA, with the ability to bind to non-nucleic acid target molecules, such as peptides, proteins, drugs, organic and inorganic molecules or even whole cells, with high affinity and specificity (Mairal et al., Anal Bioanal Chem 2008, 390: 989–1007). PDGF is one of the numerous proteins regulating cell growth and division. It is considered a potent activator for the cell types essential for tissue repair and wound healing (GF. Pierce et al., Biochem Apr 1991, 45 (4): 319-26). In our system, we used a PDGF-specific aptamer based locking system, as described by Douglas et al. Each lock is essentially composed of two complementary oligonuleotidic strands - an aptamer strand specific to PDGF and a strand complementary to it.
Aptamer strand: 5'TACTCAGGGCACTGCAAGCAATTGTGGTCCCAATGGGCTGAGTA3'
Aptamer locking strand: 3'ATGAGTCCCGACACGTTCGTTAACACCAGGGTTACCCGACTCAT5'
When Human PDGF-BB interacts with such a hybrid, it associates with the aptamer strand and the two strands of the lock dissociate. In other words, the complementary strand is displaced by PDGF because it has a higher affinity to the aptamer (Kd = 0.129±0.011 nM) (Green et al., Biochemistry 1996, 35: 14413-14424). To enhance the efficiency of the system, the aptamer locking strand is designed to be partially complementary to the aptamer strand. Such a design with shorter complementary sequences (24 bp) combined with a stretch of 16 mismatches between the two strands, facilitates strand displacemnet and hence, opening of the lock by PDGF. However, the lock is still stable enough when the Origami box is closed. The locks were hence designed as described in Fig. 2(a). The two strands of the lock are attached to the the origami box by means of origami attachment sequences, complementary to the origami scaffold.
In order to see how efficiently this lock and key system works we had to come up with an assay to characterize its functioning. To actualize this, Black Hole Quencher (BHQ) labeled aptamer strands and Cyanine 3 (Cy3) labeled aptamer locking strands were used to form the lock. In principle, when the DNA origami box is closed, the fluorescence of the Cy3 fluorophore is quenched due to its proximity to the BHQ (Fig. 2 (a)). In the presence of PDGF, When the box is open, the distance between the BHQ and Cy3 is large enough to observe a strong Cy3 fluorescence (Fig. 2 (c)). Consequently, opening of the structure can be detected by an increase in the Cy3 fluorescence signal.
<a rel="lightbox[aptamer_lock]" title="Labeled aptamer lock" href="http://openwetware.org/images/b/bd/BM12_Nanosaurs_Aptamer_lock_800.jpg"><img src="http://openwetware.org/images/1/10/BM12_Nanosaurs_Aptamer_lock_250.jpg"></a>
Fig. 2 Lock Sequences.
Spectrophotometric Measurements
In all our experiments, the lock is a hybrid of the complete aptamer strand and the complete aptamer locking strand. These strands will heneceforth be refered to as the aptamer strand and the aptamer locking strand respectively. Unless otherwise specified, the mention of a "lock" refers to a hydrid of the complete aptamer and aptamer locking strands, labeled with BHQ and Cy3 respectively. Whenever, labeled strands were used, the aptamer strand was labeled with BHQ and the aptamer locking strand was labeled with Cy3. All the samples were prepared as described under <a href="http://openwetware.org/wiki/Biomod/2012/TU_Dresden/Nanosaurs/Lab_book#protocols">(Lab Book -> Protocols)</a>.
The legend below (Fig. 3) shows all the components mentioned here.