BME103:T930 Group 1
| Home People Lab Write-Up 1 Lab Write-Up 2 Lab Write-Up 3 Course Logistics For Instructors Photos Wiki Editing Help | |||||||||||||||||||||||||||||||||||||
OUR TEAMLAB 1 WRITE-UPInitial Machine Testing
For Those who don't know that this machine is or what it does, this is called an Open PCR machine. PCR stands for polymerase chain reaction, and this machine helps us create specific strands of DNA. The machine goes through steps to recreate the DNA. It will heat up to break apart the DNA strands and then it cools down to allow polymer chains to attach to the target DNA sequence. Once the primers are attached the machine will heat up again so that the protein in charge of DNA construction will activate and bind to the polymers and then start to build the DNA sequences that are targeted. This machine is capable of creating millions of segments of this specific DNA sequence in just a hour or two. This machine can of course be improved but for many uses this machine is fine the way it is. If we improve this machine the process that the machine goes through will most likely be the same but the hardware of the Open PCR machine can be changed. Say we wanted to make the cycle times quicker we could improve the heating elements of the machine so that the heating and cooling will be faster and more effective.
When we unplugged the mounting plate from the open PCR circuit board, the display screen on the PCR box did not work. When we unplugged the white wire that connects the open PCR circuit board to the heating block, there was no temperature reading on the display screen.
(First Open PCR test: 10/25/12. We had a successful and simple run of PCR)
ProtocolsPolymerase Chain Reaction
Flourimeter Measurements (Add your work from Week 3, Part 2 here) Samples
Research and DevelopmentSpecific Cancer Marker Detection - The Underlying Technology The r17879961 cancer-associated sequence (AAACTCTTACACTGCATACA) will produce a DNA signal because of its nucleotide variation (ACATTGC to ACACTGC). This T-C change results in an isoleucene to threonine substitution. In a study in Finland, patients with colorectal cancer (CRC), the most common cancer associated with the DNA sequence change, had the allele 7.8% of the time while patients without CRC had the allele in 5.3% of patients, showing a significantly higher association in CRC patients.[1] PCR detection will only give a signal if this allele is present.
Results
| |||||||||||||||||||||||||||||||||||||



