BME103:T130 Group 3
| Home People Lab Write-Up 1 Lab Write-Up 2 Lab Write-Up 3 Course Logistics For Instructors Photos Wiki Editing Help | |||||||||||||||||||||||||||||||||||||||||||||||||||
OUR TEAMLAB 1 WRITE-UPInitial Machine Testing
A Polymerase Chain Reaction (PCR) Machine (shown in the above image) is used to create large quantities of specific DNA sequences. This process consists of various heating and cooling cycles to unzip DNA strands and isolate the wanted DNA strands. Experimenting With the Connections When the Liquid Crystal Display (LCD) screen is disconnected from the open PCR circuit board, the LCD screen is shut off. The circuit board provides the power and input signals for the LCD screen, therefore, when the two parts are not connected the LCD screen will not function. When the 16-tube PCR block is disconnected from the PCR circuit board the block will not heat or cool. The fan and lid heater are both connected to the PCR circuit board with wires, so if this connection is disrupted, those parts will not function. Test Run (Write the date you first tested Open PCR and your experience(s) with the machine)
ProtocolsPolymerase Chain Reaction
Patient 2
(Add your work from Week 3, Part 2 here)
Research and DevelopmentSpecific Cancer Marker Detection - The Underlying Technology Polymerase Chain Reaction, also known as PCR, is used to reproduce or amplify specific sections of DNA. A PCR machine carries out this reaction synthetically. Components of a PCR reaction: Template DNA: This is the initial strand of DNA used to amplify in the PCR machine. DNA can contain a certain sequence located on a gene that has been linked with having the disease of cancer. Only one copy of this sequence of nucleotides is located in the cell out off around 6 billion individual nucleotides. The purpose of PCR is to locate this strand using a primer and then amplify the sequence. Primer: A reagent that is artificially synthesized DNA sequence that binds specifically to the target sequence of the template DNA, in this case the sequence that is linked with cancer. If the target sequence is not present on the template DNA, then the primer will not bind and amplification will not occur. Taq Polymerase: This is an enzyme that drives DNA replication. Polymerase builds each single strand of DNA marked by a primer into a new, double-stranded DNA segment. It works by finding the ends of the primers, finding free nucleotides from an added solution, then it scans the template DNA to match the proper nucleotides and attaches these nucleotides with hydrogen bonds. The benefit of using Taq Polymerse is that it can withstand extreme temperatures and does not denature during the process of the PCR reaction. Magnesium Chloride: This compound is added to the reaction mixture and binds to the Taq Polymerase, it is used to help the reaction function smoothly and can be adjusted to control the speed of the reaction. dNTP’s: This is the mixture of free bases needed to combine to make new DNA strands that are the product of this reaction.
Baye’s Rule is then used to allow understanding of the limitations of the tests.
Primer: AACTCTTACACTCGATACAT
Reliability (Baye's Rule) C=cancer present Conditional Probabilities
ResultsPositive Test---------------------------------A1---------------------------------A2---------------------------------A3--------------------------------A4---------------- B1--------------------------------------------B2---------------------------------B3---------------------------------B4--------------------------------H2O----------------
| |||||||||||||||||||||||||||||||||||||||||||||||||||





