BME103:T930 Group 12

From OpenWetWare
Revision as of 05:26, 15 November 2012 by Nathan Moore (talk | contribs) (Protocols)
Jump to navigationJump to search
The printable version is no longer supported and may have rendering errors. Please update your browser bookmarks and please use the default browser print function instead.
BME 103 Fall 2012 Home
People
Lab Write-Up 1
Lab Write-Up 2
Lab Write-Up 3
Course Logistics For Instructors
Photos
Wiki Editing Help

OUR TEAM

Error creating thumbnail: File missing
Name: Philip Remick
Role(s)
Error creating thumbnail: File missing
Name: David Tze
Role(s)
Error creating thumbnail: File missing
Name: Ryan Magnuson
Role(s)
Error creating thumbnail: File missing
Name: Nathan Moore
Role(s)
Error creating thumbnail: File missing
Name: Divya Amrelia
Role(s)

LAB 1 WRITE-UP

Initial Machine Testing

The Original Design
(Add image of the full OpenPCR machine here, from the Week 3 exercise. Write a paragraph description for visitors who have no idea what this is)

Experimenting With the Connections

When we unplugged the LCD plate from the Open PCR circuit board, the display of the machine turned off (since it stopped sending data to the display). The circuit board sends electricity through the wires, therefore if the LCD plate is not plugged into the circuit board, it will not work.

When we unplugged the white wire that connects the Open PCR circuit board to the 16 tube PCR block, the machine could not record the temperature. This defeats the whole purpose of the machine since it needs to heat the tubes to the specific temperatures.


Test Run

On October 25, 2012, we experimented with the Open PCR. The experience was not pleasant as the machine took an hour and forty minutes to finish the experiment. The time estimate was also incorrect as it fluctuated. Fortunately, the experiment was a success as the machine finished the testing, revealing whether the DNA contained mutations. (Write the date you first tested Open PCR and your experience(s) with the machine)




Protocols

Polymerase Chain Reaction

The process of the polymerase chain reaction (PCR) is used to amplify specific sequences of DNA and create thousands to millions of copies. The process depends on thermal cycling, which continually heat and cool the samples in order for DNA polymerase and primers to effectively replicate the specific DNA.

Components of PCR
1. GoTaq® Colorless Master Mix 2X
2. Upstream primer 10μM
3. Downstream primer 10μM

4. DNA template
5. Nuclease


Reagent Volume
Template DNA (20 ng) 0.2 μL
10 μM forward primer 1.0 μL
10 μM reverse primer 1.0 μL
GoTaq master mix 50.0 μL
dH20 47.8 μL
Total Volume 100.0 μL
  • Male Patients: Test Tubes: 1-3
    • ID: 85002
  • Female Patients: Test Tubes: 4-6
    • ID: 34994
  • Cancer DNA Template: Test Tube: 7
  • Negative Control: Test Tube: 8

"The Steps" 1. Label DNA Samples 2. Use the micro-pipetter and transfer forward primers, reverse primers, Taq polymerase, and dNTP to each of the 8 labeled samples. Replace tip of pipetter to avoid contamination 3. Place samples into Open PCR machine 4. Close lid and tighten 5. Run the machine to the following settings

  • Stage One: 1 cycle, 95 degrees Celsius for 3 minutes
  • Stage Two: 35 cycles, 95 degrees for 30 seconds, 57 degrees for 30 seconds, 72 degrees for 30 seconds
  • Stage Three: 72 degrees for 3 minutes
  • Final Hold: 4 degrees Celsius

(Add your work from Week 3, Part 2 here)




Research and Development

Specific Cancer Marker Detection - The Underlying Technology

PCR or polymerase chain reactions are used to identify genes by making copies of specific DNA sequences and amplifying the reactions. There are a variety of applications for PCR including DNA cloning, the diagnosis of hereditary diseases, and the identification of genetic fingerprints. In this case, PCR was used to diagnose a gene known to predict certain hereditary diseases. PCR uses thermal cycling in which the DNA is amplified, generating thousands to millions of copies of the particular gene.
Before the process is described, here is some terminology to know:

Template DNA- the sequence being detected.

Primers- Initiate the start site for DNA replication.

Taq polymerase- an enzyme that grabs bases, and matches them to the DNA strand, replicating the strand.

Magnesium Chloride (MgCl2)- a cofactor that binds to Taq and helps it work more efficiently.

dNTP’s -the individual nucleotides floating in the sample tube that will act as building block subunits to be used by the Taq.

The process is as follows:

•The sample is heated to 95 degrees Celsius to separate strands and expose the bases.

•The primers are added to the sample and it is cooled to 57 degrees Celsius so that the separated DNA strands try to reconnect. The primers will bind to the strands in the phase preventing them from reconnecting.

•The sample is then heated to 72 degrees Celsius and Taq enzymes attach and start replication, with the help of magnesium chloride to help the enzymes work more efficiently.

•The cycle is repeated many times

Here are step-by-step illustrations of how the primer binds to the wanted DNA template, and how the Taq polymerase amplifies the DNA:

Error creating thumbnail: File missing
A description of the image goes here
Error creating thumbnail: File missing
A description of the image goes here
Error creating thumbnail: File missing
A description of the image goes here
Error creating thumbnail: File missing
A description of the image goes here

Images from (http://openpcr.org/use-it/)

The r17879961 sample is a cancer causing polymorphism prevalent in homo sapiens. It is located in chromosome 22 and is identified by an allele change of ATT → ACT. This missense causes a residue change of I [Ile] ⇒ T [Thr]. Here is the sequence surrounding the mutation:

5' AACTCTTACAC/TTGCATACAT 3'

3' TTGAGAATGTG/AACGTATGTA 5'

To detect this sequence using open PCR, the primers must first be constructed. In this case, the reverse primer would be 5' AACTCTTACACTGCATACAT 3', and the forward primer would be 3' TGGTATAAGACATTCCTGT 5'. The forward primer is located 200 base pairs to the left of the reverse primer, attaching to the opposite strand. The strand needs to be at least 200 base pairs long so that the DNA may be easier detected if the results are positive. If the sample produces positive results, it means that the r17879961 gene is present, so the primers will bind to this gene, replicating exponentially and producing thousands to millions of copies of DNA. If the sample being tested gives us negative results and does not contain this sequence, there will only be around 30 replicated strands of DNA, rather than millions copies since the primers won’t bind to the gene.

To identify whether the samples being tested are positive or negative, a green fluorescent dye was used . Each sample, along with a couple drops of Sybr green indicator were placed on a slide. The slide was placed in a dark box and a picture was taken of each sample. The pictures were then analyzed using a software program, which was able to determine the positive samples based on the amount of fluorescence in each sample.

Bayes Rule
Bayes rule is a statistical theorem that utilizes all available data to help account for false positives and negatives in diagnostic tests. In this case, Bayes rule will be used to determine the probability of a positive test result when cancer is present. The equation for the Bayes theorem is:
p(C/T)= [p(T/C)*p(C)]/[{p(T/C)*p(C)}+{p(T/~C)*p(~C)}]

The affected gene is checkpoint kinase 2, and in a study of 180 patients the mutation has been shown to occur in 1.1% of population, while the normal gene occurs in 98.9% of the population. The mutations have been linked most closely to prostate and colorectal cancer, but are also associated with Li-Fraumeni syndrome, breast cancer, sarcomas, and brain tumors. According to a study in Finland, the gene was observed in 7.8% of patients with colorectal cancer, and 5.3% of the healthy population (Kilpivaara et al., 2006).

Results

Sample Integrated Density DNA μg/mL Conclusion
PCR: Negative Control 59029706 F6 G6
PCR: Positive Control 103221738 F7 G7
PCR: Patient 1 ID 85002, rep 1 68983895 F8 G8
PCR: Patient 1 ID 85002, rep 2 161582057 F9 G9
PCR: Patient 1 ID 85002, rep 3 339095 F10 G10
PCR: Patient 2 ID 34994, rep 1 26308876 F11 G11
PCR: Patient 2 ID 34994, rep 2 36927888 G12
PCR: Patient 2 ID 34994, rep 3 34338469 F13 G13


KEY

  • Sample =
  • Integrated Density =
  • DNA μg/mL =
  • Conclusion =