BME103:T930 Group 14

From OpenWetWare
Revision as of 06:12, 15 November 2012 by Breanna Pratt (talk | contribs) (Results)
Jump to navigationJump to search
The printable version is no longer supported and may have rendering errors. Please update your browser bookmarks and please use the default browser print function instead.
BME 103 Fall 2012 Home
People
Lab Write-Up 1
Lab Write-Up 2
Lab Write-Up 3
Course Logistics For Instructors
Photos
Wiki Editing Help

OUR TEAM

Error creating thumbnail: File missing
Name: Jake Lindquist
Protocol Planner
Error creating thumbnail: File missing
Name: Breanna Pratt
Protocol Planner
Error creating thumbnail: File missing
Name: Kirsten Jefferys
Open PCR Machine Engineer
Error creating thumbnail: File missing
Name: Ben Alcron
Open PCR Machine Engineer
Error creating thumbnail: File missing
Name: Carlos Duarte
Research and Design Scientist
Error creating thumbnail: File missing
Name: Bryce DeSimmone
Research and Design Scientist

LAB 1 WRITE-UP

Initial Machine Testing

The Original Design



Description of Open PCR Device

The Open PCR device is thermo-cycler that helps to create strands of DNA. PCR stands for polymerase chain reaction. The Open PCR consists of a heating lid that clamps down on mini test tubes that are held 16-tube PCR main heating block. It also has a cooling fan to help bring down the temperature when it is necessary in the running experiment. The Open PCR alternates between temperatures in order to properly separate deoxyribose nucleic acid (DNA) strands, let primers bind to these strands, and then finish replication of DNA. Then the process repeats for several cycles. The LED screen displays the temperature, the cycle number over how many cycles total, and the ETA time until the test in completed. It heats up to 110 degrees Celsius by default, while its cool temperature sits at 25 degrees Celsius.


Experimenting With the Connections

When we unplugged the LED from the Open PCR circuit board, the machine stop displaying information on the LED screen.

When we unplugged the white wire that connects the Open PCR circuit board to main heat sink, the machine incorrectly displays the temperature as negative 40 degrees Celsius.

Test Run

First test was an experimental run to be sure the machine was running properly. This test was conducted on October 25th, 2012 and the test was successful.



Protocols

Polymerase Chain Reaction

The Polymerase Chain Reaction is a process that relies on thermal cycling allowing the DNA to be broken apart and replicated. This biochemical process works by separating a strand of DNA allowing a primer to target and begin replicating a segment of DNA. This separation, replication, and amplification of a specific DNA strand occurs within the machine during the thermal cycling.

  • Procedure:
  1. Obtain DNA samples and clearly lab each tube with the sample name.
  2. 50 μL of the PCR reaction mixture was added to each 50 μL sample of patient DNA. Three samples of each patient were prepared along with one sample each of a positive control and a negative control.
  3. The eight prepared samples were placed into the PCR Machine, the lid must be screwed down until it rests on the test tubes.
  4. The PCR was run with a program of 30 cycles of the following steps:
    1. 90ºC for 30 seconds
    2. 57ºC for 30 seconds
    3. 72ºC for 30 seconds.

PCR Master Mix Components

GoTaq® Colorless Master Mix, 2X

Upstream primer, 10μM

Downstream primer, 10μM

DNA template

Nuclease-Free Water

Note: GoTaq® DNA Polymerase is supplied in 2X Colorless GoTaq® Reaction Buffer (pH 8.5), 400μM dATP, 400μM dGTP, 400μM dCTP, 400μM dTTP and 3mM MgCl2.


Reagent Volume
Template DNA (20 ng) 0.2 μL
10 μM forward primer 1.0 μL
10 μM reverse primer 1.0 μL
GoTaq master mix 50.0 μL
dH2O 47.8 μL
Total Volume 100.0 μL

The Samples

Patient ID Sex Age
64129 M 48
53409 M 59

Fluorimeter Setup

Error creating thumbnail: File missing
Flourimeter setup
Error creating thumbnail: File missing
Sample Drop
  • Procedure:
  1. The hydrophobic slide was placed onto the LED box and the first two rows of nodes were centered with the LED.
  2. For each sample two drops of the Sybr Green Dye was added to the center nodes of the slide. One drop for each node, or until the two drops coalesced.
  3. Two drops of the sample patient (or positive or negative control as appropriate) solution were added to the dye.
  4. The LED was turned on and the phone camera was centered onto the drop, held up by the stand.
  5. The dark box was placed over the whole setup and closed as completely as possible.
  6. A picture was taken and sent to the ImageJ program to be analyzed.
  7. The drop was removed and disposed of and the slide was re centered on the next two nodes.
  8. The whole procedure was repeated for each sample with the phone in the same place in relation to the drop throughout the entire procedure.


ImageJ Procedure

  1. Attach the image to an E-mail to be sent from the smart phone to the ImageJ Software Operator
  2. Save the image to a computer with ImageJ software, opening the image to be analyzed.
  3. In the ImageJ software open the analyze toolbar and mark the following boxes under Set Measurements: Area, Mean Grey Area Value, Integrated Density
  4. Once the image is opened in ImageJ use the top drop down menu to select "Image" and then "Color" and then "Split Screen"
  5. Only use the green channel, closing out the red and blue channel
  6. Use the oval tool to select only the drop of liquid, getting as little background as possible while not cutting any of the drop out.
  7. After selecting only the drop press Ctrl+M
  8. Move the circle to the background image without changing the size by clicking and dragging the circle
  9. Finally, save the results as an excel spreadsheet (set by default)


Fluorimeter Measurements

Image Number Drop 1 Drop 2
1 Sybr Green Calibration
2 Sybr Green Positive Control
3 Sybr Green Patient 1 Sample A
4 Sybr Green Patient 1 Sample B
5 Sybr Green Patient 1 Sample C
6 Sybr Green Negative Control
7 Sybr Green Patient 2 Sample A
8 Sybr Green Patient 2 Sample B
9 Sybr Green Patient 2 Sample C
10 Sybr Green Water Blank





Research and Development

Specific Cancer Marker Detection - The Underlying Technology

To understand how a Polymerase Chain Reaction machine works, first an understanding of how DNA replicates in the human body must be explained. DNA must replicated to form new identical cells so that the organism the cells are supporting can grow and adapt to conditions it faces. The replication process is very complicated and involves a series of enzymes. In a nutshell, DNA begins with a double helix structure. Once unwound, by the enzyme helicase, the base pairs (Adenine, Thymine, Guanine, and Cytosine) that were held together by hydrogen bonds are now exposed and able to bind with free floating dNTPs with the help of DNA Polymerase III after a primer has been laid down.

The step of adding a primer is extremely important. Without an initial strand of RNA to allow DNA Polymerase III to bind, replication would not occur. This is extremely important for our experiment involving the PCR machine. We are testing to see if a cancer gene is present in patients, and without the initial DNA primer being able to bind, we can tell if the cancerous genes are present in that person because the DNA would not be amplified. More on that later.

When using an Open PCR (Polymerase Chain Reaction) machine for the first time, you must first make sure that you have a computer capable of running the software and download it. After the software is loaded, plug in the Open PCR machine and prepare your DNA samples that were submitted to be tested for the cancer marker. First, you must prepare the samples for amplification by adding the sample DNA, Taq Polymerase (for replication), MgCl2, and the dNTPs. This experiment focused on identifying a cancer associated gene (rs17879961) that was the result of a missense mutation (a change in the sequence ATT to ACT) which would cause the protein transcribed to become threonine instead of isoleucine. That sequence is related to patients getting Breast Cancer and Colorectal Cancer. The DNA primer being used for the detection of this cancer sequence is going to be AAACTCTTACACTGCATACA, which has the missense mutation within it. The way to know if the sample DNA has a positive result for the cancer gene is if amplification occurs. The primer will bind to the DNA if the cancer sequence is present and the strands will replicate exponentially, whereas if the cancer marker is not present, the primer will not bind to the DNA and it will not replicate because Taq Polymerase will not be able to bind. After the samples are prepared for amplification, the PCR program must be set up. To mimic the replication process of DNA in human cells, we manipulate the system by adding Taq Polymerase instead of DNA Polymerase III because the Taq Polymerase is heat resistant, and heat is going to be used to take place of the enzymes that originally initiate and carry out the DNA replication process. The temperatures that need to be programmed into the PCR are 95˚C (separates the DNA strands to prepare for replication), 57˚C (causes the primers to bind to the DNA), and 72˚C (causes Taq Polymerase to be initiated). There should be 30 cycles entered into this program to make sure ample amplification has occurred. After the 30 cycles are complete, the user can take out the sample and freeze them for later use.

When the reaction is finished, the samples can be tested to see if the cancerous gene is present. As discussed before, the primer has to bind with a very specific section of the DNA to initiate replication (Adenine can only bind to Thymine and Guanine can only bind to Cytosine). If the DNA has been replicated exponentially and a large quantity of the target DNA now lies within your sample, you know that the specific primer matched with the DNA strand and the cancerous gene is present. If no replication has occurred and a small amount of DNA is still in the sample, however, you can conclude that the DNA is free of the cancer gene because the primer could not match up with the strand. That would make Taq Polymerase unable to bind and add the dNTPs so the DNA could be copied.

When looking at the statistical significance of the data, Bayesian Reasoning was applied, which is p(CT)= (p(TC)*p(c))/((P(TC)*p(C))+(p(T~C)*p(~c)). The proportion of patients with positive results is the proportion of A compared to A+C, where the top is A and the bottom portion is A+C. If applied to a group of 10,000 patients, where 1% have cancer, 80% of people with cancer will get a positive result, and 9.6% will also get a positive result, we found that the frequency of this cancer: 80/(80+950) = 7.8%.


[math]\displaystyle{ P(CT) = \frac{P(TC)xP(c) )\, (P(TC)}{P(B)}. \, }[/math]

\frac{P(TC)\, P(c)} {(P(TC)\, P(c))+(p}. \,</math>

The first image is an unamplified template DNA sequence. The next image shows the DNA becoming denatured (separated) due to the high temperature of 95˚C. In the next image shows the the DNA strand being chilled to 57˚C, causing short primer pieces of DNA to bind to the two strands of the DNA at opposite ends of the sequence to then be amplified. Taq Polymerase then binds to the primers and extends them at a temperature of 72˚C. This process results two new double stranded copies of the original template DNA and the process is repeated multiple times to create many copies of the template strand.



Results

Error creating thumbnail: File missing
Water Drop
Error creating thumbnail: File missing
Calf Thymus DNA


Sample Integrated Density DNA μg/mL Conclusion
PCR: Negative Control 2980332 0.5449091318 No Signal
PCR: Positive Control 12138637 2.219368 Positive
PCR: Patient 1 ID 64129, rep 1 5320075 0.912696 No Signal
PCR: Patient 1 ID 64129, rep 2 3769062 0.6891166 No Signal
PCR: Patient 1 ID 64129, rep 3 2996412 0.547849 No Signal
PCR: Patient 2 ID 53409, rep 1 4731227 0.865034096 No Signal
PCR: Patient 2 ID 53409, rep 2 6332582 1.1578179076 No Signal
PCR: Patient 2 ID 53409, rep 3 5511982 1.0077834706 No Signal


KEY

  • Sample = Samples are the gene solutions of the 2 patients' DNA being tested for a cancer gene. A positive control and negative control are included for comparison reasons; a positive control should (to the best of our knowledge) test for the cancer gene, and the negative control should not have the cancer gene.
  • Integrated Density =
  • DNA μg/mL =
  • Conclusion =


Sample Area Mean Raw Integrated Density
Patient: 64129 Rep 1 120426 47.458 5715170
Patient: 64129 Rep 1 (BG) 120426 3.281 395095
Patient: 64129 Rep 2 104396 38.328 4001251
Patient: 64129 Rep 2 (BG) 104396 2.224 232182
Patient: 64129 Rep 3 126702 27.463 3479586
Patient: 64129 Rep 3 (BG) 126702 3.813 483174
Patient: 53409 Rep 1 105038 47.476 4986790
Patient: 53409 Rep 1 (BG) 105038 2.433 255563
Patient: 53409 Rep 2 111698 58.961 6585858
Patient: 53409 Rep 2 (BG) 111698 2.268 253276
Patient: 53409 Rep 3 114600 50.648 5804245
Patient: 53409 Rep 3 (BG) 114600 2.55 292263
Negative Control 150301 22.966 3451847
Negative Control (BG) 150301 3.137 471515
Blank - Water 135425 29.629 4012574
Blank - Water (BG) 135425 2.721 368551
Positive Control 94416 131.113 12379192
Positive Control (BG) 94416 2.548 240555


KEY

  • Sample =
  • BG =
  • Area =
  • Mean =
  • Raw Integrated Density =