BME103:T930 Group 3 l2

BME 103 Fall 2012	Home People Lab Write-Up 1 Lab Write-Up 2 Lab Write-Up 3 Course Logistics For Instructors Photos Wiki Editing Help
OUR TEAM Name: Student Role(s) Name: Student Role(s) Name: Student Role(s) Name: Student Role(s) Name: Student Role(s) LAB 2 WRITE-UP Thermal Cycler Engineering Our re-design is based upon the Open PCR system originally designed by Josh Perfetto and Tito Jankowski. System Design Key Features Instructions Protocols Materials PCR Protocol DNA Measurement Protocol Research and Development Background on Disease Markers 1.) The amyloid Beta precursor protein for Alzheimer's - rs63751263 (http://omim.org/entry/104760#0008) AGACGGAGGAGATCTCTGAAGTGAAG [A/C] TGGATGCAGAATTCCGACATGACTC 2.) Ubiquitin-like Modifier-activating enzyme for Spinal muscular atrophy - rs80356547(http://omim.org/entry/314370#0002) GATGGCGTGGCCAATGCCCTGGACAA [C/T] GTCCATGCCCGTCAGTTTGGAGGCG Primer Design Illustration