The printable version is no longer supported and may have rendering errors. Please update your browser bookmarks and please use the default browser print function instead.
BME 103 Fall 2012
|
Home People Lab Write-Up 1 Lab Write-Up 2 Lab Write-Up 3 Course Logistics For Instructors Photos Wiki Editing Help
|
|
OUR TEAM
LAB 2 WRITE-UP
Thermal Cycler Engineering
Our re-design is based upon the Open PCR system originally designed by Josh Perfetto and Tito Jankowski.
System Design
Error creating thumbnail: File missing
All wood structures will be replaced with a high density plastic material. The screws will be replaced with snap on hinges.
Key Features
Instructions
- Place the base of the PCR on a flat surface
- Attach the back panel of the casing via interlocking sections
- Attach both side to the back panel as well as the base
- Snap the lid components onto the top of the open PCR
- insert internal devices in appropriate places
- Snap the front panel onto the 3 sides of the PCR to complete the external shell of the PCR
Protocols
Materials
| Supplied in the Kit
|
Amount
|
| PCR Machine
|
1X
|
| Sybr Green Buffer
|
1μL (Can be diluted up to 10,000 times)
|
| Regular Buffer (Magnesium Chloride)
|
1μL (Can be diluted up to 10,000 times)
|
| 4 bases
|
25μL
|
| Primers
|
25μL
|
| Micropipets
|
4X
|
| ImageJ Installation Disc
|
1X
|
| DNA Polymerase
|
5,000 units/mL
|
| Supplied by User
|
Amount
|
| DNA samples
|
1 pipet droplet
|
|
|
|
PCR Protocol
DNA Measurement Protocol
Research and Development
Background on Disease Markers
The disease marker being used is SNP (single nucleotide polymorphism) rs35685286. This is the marker for sickle-cell disease found on chromosome 11. Patients with sickle-cell disease have red blood cells that are mishapen and are a "sickled" or crescent shape. This results in less oxygen being carried to the patient's body tissues. Therefore, patients experience crisis, where they have severe pain in their bones in their backs or chest. These symptoms can last for hours or even days.
More information about this particular SNP can be found at: http://www.ncbi.nlm.nih.gov/projects/SNP/snp_ref.cgi?rs=35685286
Primer Design
The forward primer for this disease is ACTCCGGACCCGTCCAACCAT and the reverse primer for a patient without sickle-cell disease would be TGAGGCCTGGGCAGGGTTGGTA. If a patient were to be positive for sickle-cell disease, their reverse primer would be TGAGGCCTGGACAGGTTGGTA. Therefore, a patient with this disease experiences the gene mutation from G binding to C to G binding to A. A positive test will be recognizable because while the DNA is replicating during the PCR process, the reverse primers will only attach to the diseased patient's DNA. Consequently, when the reaction is complete and the SYBR green is added, the diseased patient's DNA will appear to glow green. If a patient does not have the disease, their DNA will be present in single strands and will appear clear when injected with SYBR green.
Illustration
Step A shows the PCR heating up to 95 degrees Celcius so the hydrogen bonds between the base pairs of the double stranded DNA can be melted and separated. Next in step B, the machine is cooled to 50 degrees Celcius where the reverse primers come in and attach to the single DNA strands to create two new double stranded DNA. Finally in step C, the PCR machine is heated up to 72 degrees Celcius and the strands are fully replicated and the process repeats for approximately 30 cycles.
|