BME103:T930 Group 17 l2

From OpenWetWare
Jump to navigationJump to search
The printable version is no longer supported and may have rendering errors. Please update your browser bookmarks and please use the default browser print function instead.
BME 103 Fall 2012 Home
People
Lab Write-Up 1
Lab Write-Up 2
Lab Write-Up 3
Course Logistics For Instructors
Photos
Wiki Editing Help

OUR TEAM

Error creating thumbnail: File missing
Doug Steinhauff
Research and Development
Error creating thumbnail: File missing
Name: Student
Role(s)
Error creating thumbnail: File missing
Name: Student
Role(s)
File:CarsonBridgers.jpg
Carson Bridgers:
Role(s)

LAB 2 WRITE-UP

Thermal Cycler Engineering

Our re-design is based upon the Open PCR system originally designed by Josh Perfetto and Tito Jankowski.


System Design


Key Features


Instructions





Protocols

Materials

Supplied in the Kit Amount
PCR Machine 1
Programming Software Access 1--Online
USB Connector 1
Power Cord 1
Sample Tubes 1 set-- Total:8
Pre-Mixed Fluid with enzymes, cofactors, etc. (Like GoTaq® Master Mix) 10 experiments
Eye Droppers (Disposable) 10



Supplied by User Amount
DNA to Test User Discretion
Computer Access 1
Power Source Access 1
Pre-Mixed Fluid with enzymes, cofactors, etc. (Like GoTaq® Master Mix)--if needed Extra fluid ordered online
Eye Droppers (Disposable)--if needed Extra droppers ordered online


PCR Protocol

1. Gather all components for PCR reaction (template DNA, primers, Taq polymerase, magnesium chloride, and dNTP’s).
2. Place template DNA into a test tube.
3. Add Primer 1 to the test tube. It will attach to the first binding site on one end of the template DNA.
4. Add Primer 2 to the test tube. It will attach to the second binding site on the opposite side of the template DNA.
5. Add nucleotides (dNTP’s) to the test tube. These free floating nucleotides will be used when extending the template DNA.
6. Add Taq polymerase to the test tube. This enzyme will bind to the specific priming site and replicate DNA at the end of the strand by adding nucleotides.
7. Add Magnesium Chloride, a cofactor that will bind to Taq polymerase and allow for greater efficiency, to the test tube.
8. Download the Open PCR software onto the computer.
9. Plug the Open PCR machine into an electrical outlet.
10. Connect the machine to the computer using the USB cable.
11. Place empty PCR tubes into the machine. Close the lid and tighten the screw until it touches the tops of the tubes. Do not over-tighten!
12. Create a new program on the machine that follows: Stage one: 1 cycle, 95 degrees Celsius for 3 minutes; Stage two: 35 cycles: 95 degrees Celsius for 30 seconds, 57 degrees Celsius for 30 seconds, and 72 degrees Celsius for 30 seconds; Stage three: 72 degrees Celsius for 3 minutes; and a final hold at 4 degrees Celsius.
13. Start the new program.
14. Wait for program to run to completion.


DNA Measurement Protocol

Research and Development

Background on Disease Markers

Alzheimer’s disease is the slow deterioration of the brain. There is no known cure for this disease and it eventually results in death. This disease usually begins with the inability to remember things that have recently happened and in the late stages patients will have much difficulty in remembering basic cognitive functions. The specific missense mutation that I am examining changes a Thymine to a Guanine on the ninth chromosome. This mutation has a 3.8 times increased risk for an early onset of Alzheimer’s. The data reference number is Rs908832. http://www.ncbi.nlm.nih.gov/projects/SNP/snp_ref.cgi?rs=908832

Cystic Fibrosis is caused by a mutation of the protein cystic fibrosis transmembrane conductance regulator. This protein regulates the movement of chloride and sodium ions. Symptoms include slow growth, accumulation of mucus, chest infections, coughing, and shortness of breath. The average patient will be able to live 37 years. The specific mutation I am looking at is a deletion of three nucleotides on the seventh chromosome and causes the deletion of phenylalanine from the polypeptide. In 1979 about 70% of all cystic fibrosis patients carried this mutation. The data reference number is rs113993960. http://www.ncbi.nlm.nih.gov/projects/SNP/snp_ref.cgi?rs=113993960



Primer Design

When testing the Alzheimer’s mutation the forward primer will be TGGCTCCACCACCTCGTGCCC and the reverse primer will be TTTGTGGGGCACGAGGTGGTG. When testing for the cystic fibrosis mutation the forward primer will be TCTTTTATAGTAACCACAAA and the reverse primer will be AACACCAAAGATATTTTCTT.


Illustration

The following illustration is an example of how the primers for Alzheimer's disease would be able to bind to the template strand. Then the TAQ Polymerase would be able to amplify the DNA and result in a positive PCR reaction. The red shows the location of the SNP.

The following illustration shows how a primer would not be able to bind to the mutation resulting in Cystic Fibrosis as it still contains the three nucleotides that would be deleted if their was a mutation present. Since the primer is designed for the mutated DNA the primer is not able to bond to the normal DNA, which results in zero amplification and a negative PCR result. The red parts show which three DNA nucleotides should be deleted due to the SNP.