BME103:W930 Group9 l2

From OpenWetWare
Jump to navigationJump to search
The printable version is no longer supported and may have rendering errors. Please update your browser bookmarks and please use the default browser print function instead.
BME 103 Fall 2012 Home
People
Lab Write-Up 1
Lab Write-Up 2
Lab Write-Up 3
Course Logistics For Instructors
Photos
Wiki Editing Help


OUR TEAM

Error creating thumbnail: File missing
Name: Tyler Ray
Research and development scientist
Error creating thumbnail: File missing
Name: Seth Howell
R&D
Error creating thumbnail: File missing
Name: Ryan
Open PCR machine engineer
Error creating thumbnail: File missing
Name: Hamas
Protocol
Error creating thumbnail: File missing
Name: Deanna
Open PCR machine engineer
Error creating thumbnail: File missing
Name: Daniela
R&D

Everyone has contributed to this project even though there are only two usernames. Every person used these two users to make edits to the wiki. Dr. Haynes said that this would be sufficient enough to give each member full participation credit for this project

LAB 2 WRITE-UP

Thermal Cycler Engineering

Our re-design is based upon the Open PCR system originally designed by Josh Perfetto and Tito Jankowski.


System Design

Error creating thumbnail: File missing

The image above portrays the main heating block located inside the OpenPCR.
Consequently, the entire dimensions of the OpenPCR will increase accordingly, to fit the new 5x5 heating block.
An example is shown in the image above, indicating that the lid of the device
will increase to accommodate the new heating block.

Key Features


The key features of the new design include

Instructions





Protocols

Materials


PCR Protocol



DNA Measurement Protocol



Research and Development

Background on Disease Markers
The disease our group chose to look at was cystic fibrosis. It is a recessive trait caused by mutations in a gene on the 7th chromosome that "Causes thick, sticky mucus to build up in the lungs, digestive tract, and other areas of the body"([1]). This disease is life threatening and has a prevalence (at birth) of 1 in 2000 to 3000 in Europe and 1 in 3500 in the U.S. [2]. The marker used is a two nucleotide deletion and has identy rs200007348 and a description of the phenotype along with location in the chromosome. can be found at [3].



Primer Design

Forward primer
5'AAAAAAACAATCTTTTAAACAC3'
Reverse Primer
3'TGTTTACTTACCGTAGCTTC5'
The disease allele will give a positive result in open pcr because both the forward and reverse primers match that allele perfectly. The non-disease allele will not give a positive result because there is a frameshift mutation between the two alleles. Two nucleotides are added into the non-disease allele (between the second, and third nucleotides before the 5' end of the reverse primer). This means that the first two nucleotides willl bind to the reverse primer, but the rest will not, and exponential replication of the disease-carrying allele will be impossible.




Illustration

DNA Amplification