BME103:T930 Group 17 l2

From OpenWetWare
Revision as of 19:57, 28 November 2012 by Kaleia Kramer (talk | contribs)
Jump to navigationJump to search
The printable version is no longer supported and may have rendering errors. Please update your browser bookmarks and please use the default browser print function instead.
BME 103 Fall 2012 Home
People
Lab Write-Up 1
Lab Write-Up 2
Lab Write-Up 3
Course Logistics For Instructors
Photos
Wiki Editing Help

OUR TEAM

Doug Steinhauff (R&D Scientist)
Kaleia Kramer (Open PCR Machine Engineer)
Name: Student
Role(s)
File:CarsonBridgers.jpg
Carson Bridgers:
Role(s)

LAB 2 WRITE-UP

Thermal Cycler Engineering

Our re-design is based upon the Open PCR system originally designed by Josh Perfetto and Tito Jankowski.


System Design

This is the original Open PCR Machine.

An Open PCR Machine can rapidly duplicate DNA, or in other terms amplify it, as well as attach marker to make traits such as cancer visible. PCR stands for polymerase chain reaction. It works by heating up samples to first denature DNA and create single stranded DNA. Then it cools to allow the primer to attach and replicate the DNA. The open PCR machine starts with an initialization step where the temperature rapidly increases to 95 degrees Celsius to create a hot-start for DNA polymerization that requires heat activation. The second step is to denature the protein, where the first cycling event heats the DNA strands at a temperature of 95 degrees Celsius for 30 seconds to melt the DNA template through the disruption of hydrogen bonding between paired bases, effectively splitting the double stranded helix into two single strands of DNA. The third step is the annealing step where the temperature is rapidly lowered to around 50 degrees Celsius to allow for the annealing of primers. The polymerase then binds to the hybrid of primers with the template to begin DNA formation. Then begins the elongation step, which differs depending on the polymerase used; typically the optimum temperature is around 75 degrees Celsius. During the elongation process, DNA polymerase synthesizes a complementary new strand of anti-parallel DNA. The amount of time required for elongation differs depending on the DNA polymerase used as well as the length of the amplified DNA fragments being used. On average, DNA polymerase amplifies at a rate of one thousand bases per minute. Next is the final elongation step where the temperature is held around 75 degrees Celsius to ensure that the DNA strand is fully elongated and will generally hold for around five minutes. Finally there is an end hold temperature that keeps the reaction at a steady temperature (between four and fifteen degrees) until the amplified DNA is ready to be utilized and further studied.


This is the Sample Holder

In this image the top has been moved aside so that the sample holder is visible. The sample holder keeps the samples in place while the PCR machine cycles. The heated lid tightens so that the inside of the lid will press against the samples without crushing them to ensure that they are heated quickly and evenly.


This is the Heat Sink and Fan

In this image the heat sink and fan have been isolated from the machine. These are used to keep the machine cool and running. When the cooling cycles begin the fan will increase speed to gradually decrease the temperature. Our goal was to


Key Features
Our group chose to redesign our Open PCR machine in the attempts of improving speed while maintaining, if not improving efficacy. To improve speed, we discussed several modifications including the addition of insulation of the lid of the PCR machine. This would seal in the heat generated by the lid, allowing the samples to match the temperature of the heated lid opposed to the 10 to 20 degree difference between the two. By providing insulation, there will be less escaping heat and the Open PCR machine will require less energy to maintain high temperatures (such as the initial 95 degrees celsius that the samples must be raised to).


Instructions
Step 1: Start with an original Open PCR machine such as the one design based upon the Open PCR system originally designed by Josh Perfetto and Tito Jankowski Step 2: Step 3:




Protocols

Materials

Supplied in the Kit Amount
PCR Machine 1
Programming Software Access 1--Online
USB Connector 1
Power Cord 1
Sample Tubes 1 set-- Total:8
Pre-Mixed Fluid with enzymes, cofactors, etc. (Like GoTaq® Master Mix) 10 experiments
Eye Droppers (Disposable) 10



Supplied by User Amount
DNA to Test User Discretion
Computer Access 1
Power Source Access 1
Pre-Mixed Fluid with enzymes, cofactors, etc. (Like GoTaq® Master Mix)--if needed Extra fluid ordered online
Eye Droppers (Disposable)--if needed Extra droppers ordered online


PCR Protocol

1. Gather all components for PCR reaction (template DNA, primers, Taq polymerase, magnesium chloride, and dNTP’s).
2. Place template DNA into a test tube.
3. Add Primer 1 to the test tube. It will attach to the first binding site on one end of the template DNA.
4. Add Primer 2 to the test tube. It will attach to the second binding site on the opposite side of the template DNA.
5. Add nucleotides (dNTP’s) to the test tube. These free floating nucleotides will be used when extending the template DNA.
6. Add Taq polymerase to the test tube. This enzyme will bind to the specific priming site and replicate DNA at the end of the strand by adding nucleotides.
7. Add Magnesium Chloride, a cofactor that will bind to Taq polymerase and allow for greater efficiency, to the test tube.
8. Download the Open PCR software onto the computer.
9. Plug the Open PCR machine into an electrical outlet.
10. Connect the machine to the computer using the USB cable.
11. Place empty PCR tubes into the machine. Close the lid and tighten the screw until it touches the tops of the tubes. Do not over-tighten!
12. Create a new program on the machine that follows: Stage one: 1 cycle, 95 degrees Celsius for 3 minutes; Stage two: 35 cycles: 95 degrees Celsius for 30 seconds, 57 degrees Celsius for 30 seconds, and 72 degrees Celsius for 30 seconds; Stage three: 72 degrees Celsius for 3 minutes; and a final hold at 4 degrees Celsius.
13. Start the new program.
14. Wait for program to run to completion.


DNA Measurement Protocol

Research and Development

Background on Disease Markers

Alzheimer’s disease is the slow deterioration of the brain. There is no known cure for this disease and it eventually results in death. This disease usually begins with the inability to remember things that have recently happened and in the late stages patients will have much difficulty in remembering basic cognitive functions. The specific missense mutation that I am examining changes a Thymine to a Guanine on the ninth chromosome. This mutation has a 3.8 times increased risk for an early onset of Alzheimer’s. The data reference number is Rs908832. http://www.ncbi.nlm.nih.gov/projects/SNP/snp_ref.cgi?rs=908832

Cystic Fibrosis is caused by a mutation of the protein cystic fibrosis transmembrane conductance regulator. This protein regulates the movement of chloride and sodium ions. Symptoms include slow growth, accumulation of mucus, chest infections, coughing, and shortness of breath. The average patient will be able to live 37 years. The specific mutation I am looking at is a deletion of three nucleotides on the seventh chromosome and causes the deletion of phenylalanine from the polypeptide. In 1979 about 70% of all cystic fibrosis patients carried this mutation. The data reference number is rs113993960. http://www.ncbi.nlm.nih.gov/projects/SNP/snp_ref.cgi?rs=113993960



Primer Design

When testing the Alzheimer’s mutation the forward primer will be TGGCTCCACCACCTCGTGCCC and the reverse primer will be TTTGTGGGGCACGAGGTGGTG. When testing for the cystic fibrosis mutation the forward primer will be TCTTTTATAGTAACCACAAA and the reverse primer will be AACACCAAAGATATTTTCTT.


Illustration

The following illustration is an example of how the primers for Alzheimer's disease would be able to bind to the template strand. Then the TAQ Polymerase would be able to amplify the DNA and result in a positive PCR reaction. The red shows the location of the SNP.

The following illustration shows how a primer would not be able to bind to the mutation resulting in Cystic Fibrosis as it still contains the three nucleotides that would be deleted if their was a mutation present. Since the primer is designed for the mutated DNA the primer is not able to bond to the normal DNA, which results in zero amplification and a negative PCR result. The red parts show which three DNA nucleotides should be deleted due to the SNP.