BME103:T130 Group 7 l2

From OpenWetWare
Revision as of 19:20, 5 December 2012 by Christopher M. Glass (talk | contribs) (Thermal Cycler Engineering)
(diff) ← Older revision | Latest revision (diff) | Newer revision → (diff)
Jump to navigationJump to search
The printable version is no longer supported and may have rendering errors. Please update your browser bookmarks and please use the default browser print function instead.
BME 103 Fall 2012 Home
People
Lab Write-Up 1
Lab Write-Up 2
Lab Write-Up 3
Course Logistics For Instructors
Photos
Wiki Editing Help

OUR TEAM

Error creating thumbnail: File missing
Name: Emily Thompson
Research & Development Scientist
Error creating thumbnail: File missing
Name: Vivian Benjes
Experimental Protocol Planner/ Research & Development
Error creating thumbnail: File missing
Name: Frances Marrett
Experimental Protocol Planner/ Editor
Error creating thumbnail: File missing
Name: Chris Glass
Open PCR Machine Engineer/ Experimental Protocol Planner
Error creating thumbnail: File missing
Name: Ryan Frantz
Open PCR Machine Engineer

LAB 2 WRITE-UP

Thermal Cycler Engineering

Our re-design is based upon the Open PCR system originally designed by Josh Perfetto and Tito Jankowski.


System Design

Correctly positioning the heating plate on the plastic sample containers proved to be difficult. To make this product more user friendly a button would be added to the heating plate. When in contact with the samples the button would signal the user via the LED display that the heating lid was correctly positioned.

This picture of the roof assembly shows where the button will be added. The blue circle would contain the button that would, when in contact with the plastic containers below, signal to the user that the heating plate was correctly positioned.

This is another image of where the button would be positioned. The relative size is also accurate as it would need to be able to detect a sample anywhere in the heating block.

The original PCR machine was make of lightweight balsa wood. While this was inexpensive it was prone to splitting along the grain and staining. The new PCR machine would be made with a stronger plastic body that would better resist wear and tear and resist becoming stained with liquids commonly seen in a lab.

The original PCR machine had a cord that was slightly short and required an extension cord in some cases. The new PCR machine would have a longer cord so as to avoid this problem.

The original PCR machine had a limited storage capacity that proved to be a problem in our large class. To make the product more attractive to educators the new machine would have double the capacity. To help minimize the cost of this addition the new product would use the same PCR blocks as before, merely double the number. To accommodate the extra load the heater and cooler would likewise need to be doubled, as well as the size of the lid, so that the samples would be insulated during the PCR reaction.


The original PCR machine was slightly difficult to understand, again to make the product more attractive to educators the new product would have key parts engraved with their names. This would allow a student to quickly identify pieces and deduce their function. No picture is shown for this proposed addition.


Key Features
1.Button to display when the heating lid is correctly positioned
2.New plastic housing to replace wood
3.Longer Power Cord
4.Doubled storage capacity
5.Key parts engraved with names (for educational purposes)


Instructions
Heating Plate Button:
This device will need to be attached to the heating plate with provided metal hardware to resist the heat generated. The button will have leads that connect to the main CPU and allow the button to display when the heating lid is in place

Plastic Housing:
The new housing will be installed in the same manner that the old housing was.

Longer Power Cord:
The longer cord will be installed in the same manner that the power cord was.

Doubled PCR Blocks:
This addition will require two PCR blocks to be installed instead of only one. Both will connect to the same CPU and carry out the same function at the same time however. The new PCR block will require the addition of a new heater and cooling unit that will be installed in the same manner that the old units were installed.

Engraved Parts:
These parts will be installed in the same manner that the old parts were.






Protocols

Materials


Supplied in the Kit

Thermal Cycler for PCR reaction
Cycling PCR kit (50)
BioRad Real Time PCR Applications Guide
Basic equipment for Fluorimetry
-"Dark Room" box
-Camera stand
-Teflon coated well slides
-Cybergreen solution
-Instructions for use

Supplied by User

Sterile gloves
Access to 120V electrical outlet
10 uL pipette
Eppendorf tube block

PCR Protocol

Polymerase Chain Reaction
To amplify samples of DNA, the OpenPCR machine was used to perform a Polymerase Chain Reaction (PCR). This technique worked by cycling a mixture of DNA Template, Primers, Taq Polymerase, Magnesium Chloride, and dNTP's through three specific temperatures to create more copies of the desired sequence. After assembling the PCR mixture, the PCR machine was programmed to perform three stages. In the first stage, the samples went through one cycle at 95⁰C for 3 minutes. The purpose of this stage was to initially denature the DNA and allow the primers to act on the DNA. The second stage put the samples through 35 cycles of 95⁰C, 57⁰C, and 72⁰C each for 30 seconds. The purpose of the first part of the second stage is to break apart the hydrogen bonds between the base pairs, denaturing the DNA sequence into two separate strands. The purpose of the low temperature is to allow primers to bind. The purpose of the middle temperature is to create an environment for Taq Polymerase to assemble a new strand that is the desired product of the entire polymerase chain reaction. The last stage, stage three, puts the samples through one cycle of 72⁰C for 3 minutes. There is a final hold of 4⁰C that preserves the DNA. The samples were then taken out of the PCR machine. The target sequence had been amplified a million times and could now be analyzed with less sensitive equipment! To analyze the sequence, see the Fluorimeter section.


DNA Measurement Protocol

To analyze the DNA samples after they've been amplified, a fluorimeter can be used. The Fluorimeter aparatus consists of a hydrophobic Teflon surface on a glass slide. There is an array of 3x10 glass wells on the surface to anchor drops in position for photographing. First, two drops of the cybergreen solution should be placed with a sterile pipet. Then two drops of amplified sample DNA should be added to the cybergreen solution with another sterile pipet. It is important to place the DNA on top of the cybergreen in order to achieve the best results and to avoid contamination of the DNA samples. The drops should then be photographed in the provided dark box with the door shut to eliminate excess background light. The slide was then moved back by two columns for the next sample. This procedure can be replicated for each of the samples.

A smartphone with adjustable settings can be used to take a photo of the samples. To achieve the best results the following settings should be used.

- Exposure to highest setting
- ISO to 800+
- White balance to Automatic
- Saturation to highest setting
- Flash off if necessary
- Contrast to lowest setting


Picture Analysis:

The pictures of each sample should be analyzed using the "image j" software. This software is open source and can be obtained free of charge. The pictures, taken with the settings listed above, can be uploaded to the "image j" software then the images can be separated into their composite colors, red, blue, and green. The green portion of the images can then analyzed using the analyze option in the software and its "INTDEN" can be recorded.

Interpreting results:

The cybergreen solution allows the amount of DNA in a sample to be determined by its "INTDEN". The cybergreen glowed green in the presence of DNA and while this glow is not visable to the naked eye, the smart phone in conjunction with "image j" is able to quantify the luminosity in terms of the "INTDEN". The brighter samples contain more DNA and have higher "INTDEN" value. This indicates that the sample reacted with the primers better. By providing positive and negative controls in the experiment the various samples can be compared and their reaction to the PCR primer can be determined.

Research and Development

Background on Disease Markers
Alzheimer's disease, a form of dimentia in which brain function is lost gradually over time, is associated with the SNP rs121918396. The sequence associated with Alzheimer's is TAG, while a normal sequence is TGG.


Primer Design

Normal bp sequence:
GGCCCAGGCCTAGGGCGAGCGGCT

bp sequence with Alzheimer's associated SNP:
GGCCCAGGCCTGGGGCGAGCGGCT


To detect the SNP associated with Alzheimer's, two primers are necessary: one forward primer and one reverse primer. The forward primer matches the top strand sequence GCCCAGGCCTAGGGCGAGCGGC. The primer binds to the bottom strand because the bottom strand has corresponding base pairs. The reverse primer located about 200bp away from the forward primer matches the sequence on the bottom strand, AACTCTTACACTGCATACAT. This primer binds to the top strand and prepares for DNA Polymerase to build a new bottom strand. The two primers are useful in the second step of PCR, when the temperature drops to 57 degrees Celsius and primers bind around the target sequence. The primer design allows the target sequence to be replicated and multiplied millions of times through PCR. If only the forward primer was being used, the DNA sequence would be replicated, but not amplified.


Illustration

Error creating thumbnail: File missing
Adapted from: http://users.ugent.be/~avierstr/principles/pcr.html